Incidental Mutation 'R7844:Timm44'
ID606509
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Nametranslocase of inner mitochondrial membrane 44
SynonymsMimt44, 0710005E20Rik, Tim44, D8Ertd118e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7844 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4259731-4275913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4269976 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 64 (L64P)
Ref Sequence ENSEMBL: ENSMUSP00000003029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003029
AA Change: L64P

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: L64P

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Slc30a6 G A 17: 74,404,093 probably null Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4275888 utr 5 prime probably benign
IGL01768:Timm44 APN 8 4266860 missense probably benign 0.00
IGL02336:Timm44 APN 8 4267692 missense probably damaging 1.00
R0505:Timm44 UTSW 8 4260532 nonsense probably null
R0883:Timm44 UTSW 8 4266592 missense probably benign
R1842:Timm44 UTSW 8 4260510 critical splice donor site probably null
R1965:Timm44 UTSW 8 4260603 missense possibly damaging 0.65
R2243:Timm44 UTSW 8 4267871 missense possibly damaging 0.91
R2318:Timm44 UTSW 8 4268307 missense probably benign 0.18
R2518:Timm44 UTSW 8 4266588 missense probably null 1.00
R4049:Timm44 UTSW 8 4260561 missense probably benign 0.00
R4489:Timm44 UTSW 8 4266654 missense possibly damaging 0.48
R4803:Timm44 UTSW 8 4267932 missense probably damaging 0.99
R5001:Timm44 UTSW 8 4275886 start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4275919 unclassified probably null
R5335:Timm44 UTSW 8 4266814 missense probably damaging 1.00
R5502:Timm44 UTSW 8 4269992 missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4266769 critical splice donor site probably null
R5700:Timm44 UTSW 8 4274171 missense probably damaging 1.00
R6004:Timm44 UTSW 8 4267747 missense probably benign 0.00
R6186:Timm44 UTSW 8 4266824 missense probably damaging 1.00
R6524:Timm44 UTSW 8 4267988 missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4267282 missense probably damaging 1.00
R6996:Timm44 UTSW 8 4266611 missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4267311 missense probably damaging 0.98
R7927:Timm44 UTSW 8 4269976 missense possibly damaging 0.71
Z1088:Timm44 UTSW 8 4268004 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGAGAATCTTGCACGGC -3'
(R):5'- TAAACTCCGCTGTCAACAGAG -3'

Sequencing Primer
(F):5'- TGAATCAGCGCTATGACCTG -3'
(R):5'- CGCTGTCAACAGAGGAGAG -3'
Posted On2019-12-20