Incidental Mutation 'R7859:Dusp22'
ID607378
Institutional Source Beutler Lab
Gene Symbol Dusp22
Ensembl Gene ENSMUSG00000069255
Gene Namedual specificity phosphatase 22
SynonymsJKAP, JSP1, 1110028K04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location30659999-30711231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30708754 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 171 (K171N)
Ref Sequence ENSEMBL: ENSMUSP00000093603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091672] [ENSMUST00000095914] [ENSMUST00000110310] [ENSMUST00000221725]
Predicted Effect probably benign
Transcript: ENSMUST00000091672
SMART Domains Protein: ENSMUSP00000089260
Gene: ENSMUSG00000069255

DomainStartEndE-ValueType
DSPc 4 141 2.62e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095914
AA Change: K171N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000093603
Gene: ENSMUSG00000069255
AA Change: K171N

DomainStartEndE-ValueType
DSPc 4 141 2.62e-48 SMART
low complexity region 180 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110310
SMART Domains Protein: ENSMUSP00000105939
Gene: ENSMUSG00000069255

DomainStartEndE-ValueType
Pfam:DSPc 12 89 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221725
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Dusp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Dusp22 APN 13 30705628 missense probably benign 0.00
IGL01734:Dusp22 APN 13 30696252 missense probably damaging 1.00
IGL01835:Dusp22 APN 13 30708683 splice site probably null
IGL02563:Dusp22 APN 13 30705645 missense possibly damaging 0.91
paused UTSW 13 30668791 splice site probably null
R0310:Dusp22 UTSW 13 30705658 missense probably damaging 0.96
R1491:Dusp22 UTSW 13 30708815 missense probably benign
R4211:Dusp22 UTSW 13 30708743 missense probably benign 0.32
R4884:Dusp22 UTSW 13 30668830 missense probably benign 0.21
R5877:Dusp22 UTSW 13 30707961 missense probably damaging 1.00
R7842:Dusp22 UTSW 13 30668791 splice site probably null
R8314:Dusp22 UTSW 13 30708931 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCATGTTCATATGTGGAACTTCACC -3'
(R):5'- TTCTGAGAAGGAGCCCTGAG -3'

Sequencing Primer
(F):5'- CCATTGCTTAAGAGGTGAGAGTCCC -3'
(R):5'- TCTCGTAGTCCTCAGAGGCAG -3'
Posted On2019-12-20