Incidental Mutation 'R7879:Stap2'
ID608669
Institutional Source Beutler Lab
Gene Symbol Stap2
Ensembl Gene ENSMUSG00000038781
Gene Namesignal transducing adaptor family member 2
SynonymsSTAP-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location55997081-56005570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56002023 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 115 (T115A)
Ref Sequence ENSEMBL: ENSMUSP00000038130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043785] [ENSMUST00000133998]
Predicted Effect probably benign
Transcript: ENSMUST00000043785
AA Change: T115A

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781
AA Change: T115A

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133998
SMART Domains Protein: ENSMUSP00000122480
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the substrate of breast tumor kinase, an Src-type non-receptor tyrosine kinase. The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that mediate the interactions linking proteins involved in signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no apparent abnormalities in most organs at the gross and histological level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Stap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01578:Stap2 APN 17 55997623 missense probably benign 0.00
IGL02087:Stap2 APN 17 56005473 missense probably damaging 1.00
IGL02876:Stap2 APN 17 55999961 missense probably benign 0.00
IGL03101:Stap2 APN 17 56002029 missense probably damaging 1.00
R0033:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R0345:Stap2 UTSW 17 56000097 missense probably damaging 0.98
R3405:Stap2 UTSW 17 55997511 missense probably benign 0.30
R3406:Stap2 UTSW 17 55997511 missense probably benign 0.30
R3929:Stap2 UTSW 17 56003156 missense probably damaging 1.00
R4210:Stap2 UTSW 17 55997827 nonsense probably null
R4543:Stap2 UTSW 17 55997604 critical splice donor site probably null
R4934:Stap2 UTSW 17 55997901 missense possibly damaging 0.69
R5748:Stap2 UTSW 17 56000475 splice site probably null
R6228:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R6617:Stap2 UTSW 17 55999746 missense probably benign
R7092:Stap2 UTSW 17 56002954 missense probably benign 0.00
R7665:Stap2 UTSW 17 55997909 missense probably benign 0.00
R8008:Stap2 UTSW 17 55997790 missense probably benign 0.05
Z1088:Stap2 UTSW 17 55999748 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACTCTGAATTGATGGGG -3'
(R):5'- CTTACTCCACTTTTACAAGGAACATA -3'

Sequencing Primer
(F):5'- GCACACCAATGAGAGGTCTTCTAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2019-12-20