Incidental Mutation 'R7879:Zkscan5'
ID608633
Institutional Source Beutler Lab
Gene Symbol Zkscan5
Ensembl Gene ENSMUSG00000055991
Gene Namezinc finger with KRAB and SCAN domains 5
SynonymsZfp95, hKraba1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145204562-145221750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 145220866 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 726 (H726P)
Ref Sequence ENSEMBL: ENSMUSP00000082814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031601] [ENSMUST00000085671] [ENSMUST00000161896]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031601
AA Change: H653P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031601
Gene: ENSMUSG00000055991
AA Change: H653P

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 1.45e-2 SMART
ZnF_C2H2 352 374 1.28e-3 SMART
ZnF_C2H2 467 489 1.82e-3 SMART
ZnF_C2H2 495 517 3.63e-3 SMART
ZnF_C2H2 523 545 7.78e-3 SMART
ZnF_C2H2 551 573 9.73e-4 SMART
ZnF_C2H2 579 601 1.08e-1 SMART
ZnF_C2H2 635 657 1.12e-3 SMART
ZnF_C2H2 691 713 5.14e-3 SMART
ZnF_C2H2 719 741 2.4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085671
AA Change: H726P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082814
Gene: ENSMUSG00000055991
AA Change: H726P

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
KRAB 216 276 5.35e-3 SMART
ZnF_C2H2 341 363 3.58e-2 SMART
ZnF_C2H2 369 391 9.73e-4 SMART
ZnF_C2H2 397 419 1.45e-2 SMART
ZnF_C2H2 425 447 1.28e-3 SMART
ZnF_C2H2 540 562 1.82e-3 SMART
ZnF_C2H2 568 590 3.63e-3 SMART
ZnF_C2H2 596 618 7.78e-3 SMART
ZnF_C2H2 624 646 9.73e-4 SMART
ZnF_C2H2 652 674 1.08e-1 SMART
ZnF_C2H2 708 730 1.12e-3 SMART
ZnF_C2H2 764 786 5.14e-3 SMART
ZnF_C2H2 792 814 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161881
SMART Domains Protein: ENSMUSP00000124544
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
KRAB 59 118 2.71e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161896
SMART Domains Protein: ENSMUSP00000124838
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
SCAN 46 155 1.59e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162168
Meta Mutation Damage Score 0.9422 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain and may be involved in transcriptional regulation. A similar protein in mouse is differentially expressed in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Other mutations in Zkscan5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Zkscan5 APN 5 145218650 missense probably damaging 0.99
R0401:Zkscan5 UTSW 5 145212575 missense probably damaging 0.99
R0458:Zkscan5 UTSW 5 145205471 missense probably damaging 0.97
R1456:Zkscan5 UTSW 5 145220988 missense probably benign 0.03
R1801:Zkscan5 UTSW 5 145220205 missense probably damaging 1.00
R2269:Zkscan5 UTSW 5 145205467 missense probably damaging 1.00
R2426:Zkscan5 UTSW 5 145220940 missense probably benign
R3085:Zkscan5 UTSW 5 145221079 missense probably damaging 1.00
R3153:Zkscan5 UTSW 5 145212627 missense probably benign
R3725:Zkscan5 UTSW 5 145220913 missense probably damaging 0.98
R4479:Zkscan5 UTSW 5 145211174 intron probably benign
R4647:Zkscan5 UTSW 5 145218830 missense possibly damaging 0.71
R5292:Zkscan5 UTSW 5 145218641 missense probably damaging 1.00
R5872:Zkscan5 UTSW 5 145220088 missense probably benign
R5873:Zkscan5 UTSW 5 145220394 missense possibly damaging 0.71
R5916:Zkscan5 UTSW 5 145205302 missense possibly damaging 0.90
R6692:Zkscan5 UTSW 5 145221084 unclassified probably null
R7092:Zkscan5 UTSW 5 145220089 missense probably benign
R7114:Zkscan5 UTSW 5 145211178 intron probably benign
R7403:Zkscan5 UTSW 5 145218593 missense probably benign 0.31
R7719:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7741:Zkscan5 UTSW 5 145221037 missense possibly damaging 0.51
R7751:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7829:Zkscan5 UTSW 5 145218703 nonsense probably null
R7874:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7875:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7876:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7884:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7899:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7902:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACACCAAGTGCTCCATG -3'
(R):5'- AGAGGCTACAGCTCCAACTG -3'

Sequencing Primer
(F):5'- AAGTGCTCCATGTGGGC -3'
(R):5'- CTTACACTGGAGGGGCTTCTC -3'
Posted On2019-12-20