Incidental Mutation 'R7885:Lrrc1'
ID609014
Institutional Source Beutler Lab
Gene Symbol Lrrc1
Ensembl Gene ENSMUSG00000032352
Gene Nameleucine rich repeat containing 1
SynonymsA430093J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location77430823-77544870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77442189 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 365 (V365E)
Ref Sequence ENSEMBL: ENSMUSP00000139226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113421] [ENSMUST00000183873]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113421
AA Change: V320E

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109048
Gene: ENSMUSG00000032352
AA Change: V320E

DomainStartEndE-ValueType
LRR 13 35 6.57e-1 SMART
LRR 36 59 1.12e2 SMART
LRR 82 104 2.15e2 SMART
LRR 105 127 3.09e1 SMART
LRR 128 150 2.14e0 SMART
LRR 151 173 3.02e0 SMART
LRR 174 196 3.47e0 SMART
LRR 197 219 6.58e0 SMART
LRR_TYP 220 243 4.72e-2 SMART
LRR 266 289 8.97e0 SMART
LRR 313 335 1.49e2 SMART
coiled coil region 440 461 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000183873
AA Change: V365E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139226
Gene: ENSMUSG00000032352
AA Change: V365E

DomainStartEndE-ValueType
LRR 36 57 3.18e1 SMART
LRR 58 80 6.57e-1 SMART
LRR 81 104 1.12e2 SMART
LRR 127 149 2.15e2 SMART
LRR 150 172 3.09e1 SMART
LRR 173 195 2.14e0 SMART
LRR 196 218 3.02e0 SMART
LRR 219 241 3.47e0 SMART
LRR 242 264 6.58e0 SMART
LRR_TYP 265 288 4.72e-2 SMART
LRR 311 334 8.97e0 SMART
LRR 358 380 1.49e2 SMART
coiled coil region 485 506 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Lrrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Lrrc1 APN 9 77435122 missense probably benign 0.00
IGL02975:Lrrc1 APN 9 77452647 missense probably damaging 1.00
IGL03063:Lrrc1 APN 9 77499269 missense probably damaging 0.99
R0610:Lrrc1 UTSW 9 77472206 missense possibly damaging 0.95
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1615:Lrrc1 UTSW 9 77435118 missense possibly damaging 0.94
R2932:Lrrc1 UTSW 9 77457439 missense probably benign 0.01
R5087:Lrrc1 UTSW 9 77457458 missense probably benign
R5907:Lrrc1 UTSW 9 77434097 missense probably damaging 0.99
R6443:Lrrc1 UTSW 9 77434032 missense probably damaging 1.00
R6502:Lrrc1 UTSW 9 77442191 missense probably damaging 1.00
R7073:Lrrc1 UTSW 9 77468565 missense probably benign 0.04
R7162:Lrrc1 UTSW 9 77432190 missense probably benign 0.13
R7177:Lrrc1 UTSW 9 77472222 nonsense probably null
R7290:Lrrc1 UTSW 9 77457839 missense probably benign 0.01
R8301:Lrrc1 UTSW 9 77544488 missense probably damaging 1.00
R8375:Lrrc1 UTSW 9 77457847 missense probably damaging 1.00
RF020:Lrrc1 UTSW 9 77452631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTCTGAAGTAGCCCAG -3'
(R):5'- TGACCATCGGTGAAGTTTAAACATC -3'

Sequencing Primer
(F):5'- CTCTGAAGTAGCCCAGGGTGTG -3'
(R):5'- AAACATCATATGCTTCTTCATGCC -3'
Posted On2019-12-20