Mutagenetix > Incidental Mutations

Incidental Mutation 'R7885:Npepps'

609021

Institutional Source

Beutler Lab

Gene Symbol

Npepps

Ensembl Gene

ENSMUSG00000001441

Gene Name

aminopeptidase puromycin sensitive

Synonyms

MP100, Psa

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.891) question?

Stock #

R7885 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97205842-97280638 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 97218648 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 701 (H701N)

Ref Sequence

ENSEMBL: ENSMUSP00000001480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001480] [ENSMUST00000167806] [ENSMUST00000172108]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001480
AA Change: H701N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000001480
Gene: ENSMUSG00000001441
AA Change: H701N

Domain	Start	End	E-Value	Type
low complexity region	3	45	N/A	INTRINSIC
Pfam:Peptidase_M1	54	442	5.2e-155	PFAM
Pfam:ERAP1_C	579	892	7.9e-72	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000128169
Gene: ENSMUSG00000001441
AA Change: H656N

Domain	Start	End	E-Value	Type
low complexity region	4	35	N/A	INTRINSIC
Pfam:Peptidase_M1	46	183	1.6e-28	PFAM
Pfam:Peptidase_M1	174	398	2.9e-100	PFAM
Pfam:ERAP1_C	535	848	2.9e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167806

SMART Domains

Protein: ENSMUSP00000130445
Gene: ENSMUSG00000001441

Domain	Start	End	E-Value	Type
low complexity region	3	45	N/A	INTRINSIC
Pfam:Peptidase_M1	54	442	3e-153	PFAM
Pfam:Peptidase_MA_2	321	465	7.4e-24	PFAM
Pfam:ERAP1_C	579	632	5.6e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172108
AA Change: H701N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127801
Gene: ENSMUSG00000001441
AA Change: H701N

Domain	Start	End	E-Value	Type
low complexity region	3	45	N/A	INTRINSIC
Pfam:Peptidase_M1	54	442	6e-153	PFAM
Pfam:Peptidase_MA_2	321	465	1.2e-23	PFAM
Pfam:ERAP1_C	579	859	5.7e-55	PFAM
low complexity region	868	886	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which hydrolyzes amino acids from the N-terminus of its substrate. The protein has been localized to both the cytoplasm and to cellular membranes. This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is involved in proteolytic events regulating the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trapped mutation exhibit dwarfism, increased anxiety, decreased pain sensitivity, and infertility in both sexes. Females fail to produce the corpus luteum of pregnancy, while males fail to copulate and have impaired spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,189,314	L608P	probably damaging	Het
Adarb1	A	G	10: 77,295,708	V649A	possibly damaging	Het
Arglu1	C	T	8: 8,667,337	R244H	possibly damaging	Het
Asic5	A	T	3: 82,006,505	Y204F	probably benign	Het
Asz1	A	G	6: 18,104,877	F76S	probably damaging	Het
Bin1	G	A	18: 32,419,843	A174T	probably damaging	Het
Bnipl	A	C	3: 95,250,240	S23A	probably benign	Het
Cd19	T	C	7: 126,412,131	T294A	probably benign	Het
Cdon	G	A	9: 35,456,522	V238I	probably benign	Het
Chd3	A	T	11: 69,356,625	D957E	probably benign	Het
Crhbp	T	C	13: 95,432,007	Q307R	probably damaging	Het
Cst3	A	G	2: 148,872,821	M112T	probably benign	Het
Dgkb	A	G	12: 38,139,426	E276G	probably damaging	Het
Exoc4	T	A	6: 33,758,066	N539K	probably benign	Het
Gm3099	A	G	14: 3,999,461	E85G	probably benign	Het
Gpatch2	A	G	1: 187,225,501		probably null	Het
Hs3st5	T	A	10: 36,828,780	Y26*	probably null	Het
Hspg2	A	T	4: 137,516,837	D802V	probably damaging	Het
Ifih1	A	G	2: 62,601,469	V846A	possibly damaging	Het
Lama4	T	A	10: 39,088,844	S1402T	probably benign	Het
Lrmda	A	G	14: 22,598,320	T73A	unknown	Het
Lrrc1	A	T	9: 77,442,189	V365E	probably damaging	Het
Lrrc37a	T	A	11: 103,503,042	Q519L	probably benign	Het
Mlc1	G	T	15: 88,977,904	D36E	probably benign	Het
Mrc2	A	T	11: 105,332,266	D445V	probably damaging	Het
Muc16	A	G	9: 18,639,464	S5178P	probably benign	Het
Nbea	A	G	3: 55,665,689	I2491T	probably damaging	Het
Ncoa1	A	G	12: 4,339,044	I77T	probably damaging	Het
Olfr733	T	G	14: 50,298,584	T242P	probably damaging	Het
Olfr837	A	T	9: 19,137,535	I181F	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Pclo	TCTAT	TCTATACTAT	5: 14,714,191		probably null	Het
Pclo	T	TTCTAG	5: 14,714,195		probably null	Het
Pi4kb	T	C	3: 94,999,076	Y645H	probably damaging	Het
Pik3r5	C	T	11: 68,492,702	A449V	possibly damaging	Het
Plat	A	G	8: 22,771,720	T45A	probably benign	Het
Platr25	T	C	13: 62,700,862	K62R	possibly damaging	Het
Ppp5c	A	G	7: 17,006,186	V410A	possibly damaging	Het
Prdm2	C	T	4: 143,134,570	A717T	probably benign	Het
Pstpip2	C	A	18: 77,794,722	T2K	probably benign	Het
Ptpn12	A	C	5: 20,998,525	S418R	possibly damaging	Het
Rint1	A	G	5: 23,805,644	S255G	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Stab2	T	C	10: 86,878,912	H1581R	probably benign	Het
Stau2	T	C	1: 16,460,353	Y114C	unknown	Het
Ticam1	T	C	17: 56,271,067	T343A	probably benign	Het
Tmem131l	T	C	3: 83,910,417	K1259E	possibly damaging	Het
Vmn2r103	T	A	17: 19,793,123	F169I	probably benign	Het
Vps33a	T	C	5: 123,535,249	K425E	possibly damaging	Het
Vwa8	T	C	14: 79,020,649	M746T	probably benign	Het
Zc3hav1	A	G	6: 38,336,663	I149T	possibly damaging	Het
Zfp708	A	T	13: 67,074,129	D62E	probably benign	Het

Other mutations in Npepps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00826:Npepps	APN	11	97236058	splice site	probably benign
IGL00904:Npepps	APN	11	97258306	missense	probably damaging	0.99
IGL00925:Npepps	APN	11	97280283	missense	probably damaging	0.97
IGL01074:Npepps	APN	11	97217811	missense	probably damaging	0.98
IGL01869:Npepps	APN	11	97236122	missense	probably damaging	1.00
IGL01879:Npepps	APN	11	97258340	missense	possibly damaging	0.66
IGL02145:Npepps	APN	11	97218502	splice site	probably null
IGL02493:Npepps	APN	11	97238159	missense	probably damaging	1.00
IGL02561:Npepps	APN	11	97229849	nonsense	probably null
IGL02957:Npepps	APN	11	97242652	missense	probably damaging	1.00
IGL03008:Npepps	APN	11	97238158	missense	probably damaging	1.00
disadvantaged	UTSW	11	97258273	critical splice donor site	probably null
put_upon	UTSW	11	97248200	critical splice donor site	probably null
Underprivileged	UTSW	11	97267644	nonsense	probably null
IGL03054:Npepps	UTSW	11	97241788	intron	probably benign
R0280:Npepps	UTSW	11	97241014	missense	possibly damaging	0.90
R0743:Npepps	UTSW	11	97206058	utr 3 prime	probably benign
R0838:Npepps	UTSW	11	97267692	splice site	probably benign
R1449:Npepps	UTSW	11	97207154	missense	probably benign	0.01
R1478:Npepps	UTSW	11	97226847	missense	probably benign	0.03
R1502:Npepps	UTSW	11	97218575	missense	possibly damaging	0.79
R1726:Npepps	UTSW	11	97224669	missense	probably damaging	1.00
R2413:Npepps	UTSW	11	97240966	missense	probably damaging	1.00
R3619:Npepps	UTSW	11	97248265	missense	possibly damaging	0.90
R4620:Npepps	UTSW	11	97238244	missense	probably damaging	1.00
R4782:Npepps	UTSW	11	97226826	missense	probably damaging	1.00
R4810:Npepps	UTSW	11	97240933	missense	probably damaging	1.00
R4998:Npepps	UTSW	11	97206107	intron	probably benign
R5086:Npepps	UTSW	11	97217799	missense	probably benign	0.01
R5289:Npepps	UTSW	11	97240927	critical splice donor site	probably null
R5740:Npepps	UTSW	11	97236068	missense	possibly damaging	0.85
R6004:Npepps	UTSW	11	97223124	missense	probably benign	0.03
R6181:Npepps	UTSW	11	97242004	missense	probably damaging	0.98
R6213:Npepps	UTSW	11	97241997	nonsense	probably null
R6244:Npepps	UTSW	11	97213790	missense	probably damaging	1.00
R6318:Npepps	UTSW	11	97218548	missense	probably damaging	0.98
R6478:Npepps	UTSW	11	97258273	critical splice donor site	probably null
R6724:Npepps	UTSW	11	97206002	utr 3 prime	probably benign
R6890:Npepps	UTSW	11	97267644	nonsense	probably null
R7035:Npepps	UTSW	11	97223139	missense	probably damaging	0.99
R7426:Npepps	UTSW	11	97213156	missense	probably benign	0.19
R7749:Npepps	UTSW	11	97267628	missense	probably benign
R7819:Npepps	UTSW	11	97248269	missense	probably damaging	1.00
R8142:Npepps	UTSW	11	97218572	missense	probably damaging	1.00
R8176:Npepps	UTSW	11	97236151	missense	probably damaging	1.00
R8237:Npepps	UTSW	11	97248200	critical splice donor site	probably null
R8355:Npepps	UTSW	11	97241974	missense	probably damaging	1.00
R8360:Npepps	UTSW	11	97229839	missense	probably benign
R8455:Npepps	UTSW	11	97241974	missense	probably damaging	1.00
R8465:Npepps	UTSW	11	97248259	missense	probably damaging	1.00
R8508:Npepps	UTSW	11	97244426	critical splice donor site	probably null
X0021:Npepps	UTSW	11	97238120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTACAGTCAGACAGGGTGTG -3'
(R):5'- GTCCACACAAAGTCAGCAAATTTG -3'

Sequencing Primer
(F):5'- CCTCCTGAGTACTGGGATTAAAG -3'
(R):5'- GTTTAAGACCGTAGACTTGGT -3'

Posted On

2019-12-20