Incidental Mutation 'R5223:Pex5l'
ID 402412
Institutional Source Beutler Lab
Gene Symbol Pex5l
Ensembl Gene ENSMUSG00000027674
Gene Name peroxisomal biogenesis factor 5-like
Synonyms PXR2, TRIP8b, Pex2, 1700016J08Rik
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.574) question?
Stock # R5223 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 33003557-33197396 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33012945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 15 (S15T)
Ref Sequence ENSEMBL: ENSMUSP00000103856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078226] [ENSMUST00000108221] [ENSMUST00000108224] [ENSMUST00000108225] [ENSMUST00000108226] [ENSMUST00000192093] [ENSMUST00000193289] [ENSMUST00000193681] [ENSMUST00000194016]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078226
AA Change: S286T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077353
Gene: ENSMUSG00000027674
AA Change: S286T

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108219
SMART Domains Protein: ENSMUSP00000103854
Gene: ENSMUSG00000027674

DomainStartEndE-ValueType
low complexity region 124 140 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
PDB:4EQF|A 266 362 8e-64 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000108221
AA Change: S15T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103856
Gene: ENSMUSG00000027674
AA Change: S15T

DomainStartEndE-ValueType
TPR 78 111 6.95e-4 SMART
Blast:TPR 112 145 2e-14 BLAST
TPR 192 225 3.19e-3 SMART
TPR 226 259 3.47e-4 SMART
TPR 260 293 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108224
AA Change: S262T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103859
Gene: ENSMUSG00000027674
AA Change: S262T

DomainStartEndE-ValueType
low complexity region 88 104 N/A INTRINSIC
low complexity region 190 204 N/A INTRINSIC
TPR 325 358 6.95e-4 SMART
Blast:TPR 359 392 2e-14 BLAST
TPR 439 472 3.19e-3 SMART
TPR 473 506 3.47e-4 SMART
TPR 507 540 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108225
AA Change: S286T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103860
Gene: ENSMUSG00000027674
AA Change: S286T

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108226
AA Change: S238T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103861
Gene: ENSMUSG00000027674
AA Change: S238T

DomainStartEndE-ValueType
low complexity region 65 81 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
TPR 301 334 6.95e-4 SMART
Blast:TPR 335 368 2e-14 BLAST
TPR 415 448 3.19e-3 SMART
TPR 449 482 3.47e-4 SMART
TPR 483 516 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192093
AA Change: S286T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141387
Gene: ENSMUSG00000027674
AA Change: S286T

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192259
Predicted Effect probably benign
Transcript: ENSMUST00000193289
AA Change: S321T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142008
Gene: ENSMUSG00000027674
AA Change: S321T

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193681
AA Change: S321T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141454
Gene: ENSMUSG00000027674
AA Change: S321T

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194016
AA Change: S321T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142196
Gene: ENSMUSG00000027674
AA Change: S321T

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation lacking isoform b exhibit exhibit reduced hyperpolarization-activated current in CA1 pyramidal neuron, impaired motor learning, impaired nest-building, decreased startle reflex, and decreased depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,904,278 (GRCm39) V273M possibly damaging Het
Acin1 CCGC CC 14: 54,880,398 (GRCm39) probably null Het
Acvr1b T A 15: 101,091,857 (GRCm39) C46S probably damaging Het
Ahi1 A T 10: 20,846,818 (GRCm39) H416L possibly damaging Het
Aspm T A 1: 139,406,072 (GRCm39) L1653Q probably damaging Het
Cacna1a G A 8: 85,313,824 (GRCm39) V1533M possibly damaging Het
Ccdc33 C T 9: 57,940,267 (GRCm39) E502K possibly damaging Het
Ctnnd1 C T 2: 84,447,133 (GRCm39) V371M probably damaging Het
Cyp2a12 A T 7: 26,735,888 (GRCm39) probably null Het
Dnai4 T A 4: 102,906,600 (GRCm39) S738C possibly damaging Het
Ep400 A G 5: 110,816,496 (GRCm39) V2675A probably damaging Het
Foxh1 T A 15: 76,552,929 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gpnmb C T 6: 49,033,139 (GRCm39) T539M probably benign Het
Hdac1-ps A G 17: 78,799,867 (GRCm39) E286G probably benign Het
Hspa9 A G 18: 35,085,724 (GRCm39) probably null Het
Hspg2 T C 4: 137,271,225 (GRCm39) L2454P probably damaging Het
Ift140 T A 17: 25,254,786 (GRCm39) I422N probably benign Het
Igkv6-32 T C 6: 70,051,207 (GRCm39) S50G probably benign Het
Il23r T A 6: 67,463,154 (GRCm39) Y113F probably benign Het
Kcnt1 A G 2: 25,793,434 (GRCm39) D636G probably benign Het
Klhl41 G A 2: 69,510,171 (GRCm39) W569* probably null Het
Klra4 T A 6: 130,039,110 (GRCm39) D94V probably damaging Het
Lca5 T A 9: 83,280,666 (GRCm39) H378L probably benign Het
Lhx8 T A 3: 154,027,281 (GRCm39) T254S probably damaging Het
Lrch3 C T 16: 32,734,767 (GRCm39) R86W probably damaging Het
Lrp2 T A 2: 69,354,397 (GRCm39) N477I probably damaging Het
Man2a1 T A 17: 65,019,266 (GRCm39) I710K probably benign Het
Ncor1 A T 11: 62,229,826 (GRCm39) Y881N probably damaging Het
Nhsl1 T A 10: 18,402,074 (GRCm39) V1100E probably damaging Het
Oprk1 T C 1: 5,659,519 (GRCm39) V83A probably benign Het
Or4p8 T C 2: 88,727,678 (GRCm39) T88A probably benign Het
Or5p62 A G 7: 107,771,915 (GRCm39) V12A probably benign Het
Or7g35 T C 9: 19,496,322 (GRCm39) V163A probably benign Het
Pacs1 C T 19: 5,195,169 (GRCm39) V472I probably benign Het
Pard3b T C 1: 62,383,272 (GRCm39) Y789H probably damaging Het
Pcdha2 T C 18: 37,073,844 (GRCm39) Y492H probably damaging Het
Pcnt T C 10: 76,216,106 (GRCm39) N2261D probably damaging Het
Plekhg4 A G 8: 106,105,581 (GRCm39) N682S probably benign Het
Poc5 A T 13: 96,539,463 (GRCm39) M335L probably benign Het
Polr1a C T 6: 71,944,891 (GRCm39) R1316W possibly damaging Het
Pp2d1 T C 17: 53,814,873 (GRCm39) H617R probably benign Het
Pramel24 T A 4: 143,454,591 (GRCm39) S296R probably benign Het
Prpsap1 T C 11: 116,378,974 (GRCm39) K65E probably benign Het
Ptgfrn T C 3: 100,952,909 (GRCm39) E775G probably benign Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Rbbp8 C A 18: 11,854,747 (GRCm39) A324E probably benign Het
Rfx6 G T 10: 51,554,092 (GRCm39) G63* probably null Het
Rpl37a T C 1: 72,751,308 (GRCm39) M47T probably benign Het
Samm50 T G 15: 84,084,831 (GRCm39) N187K probably benign Het
Skic2 A G 17: 35,064,142 (GRCm39) probably null Het
Slamf9 T C 1: 172,303,799 (GRCm39) I48T possibly damaging Het
Slc2a12 A G 10: 22,577,931 (GRCm39) K576E probably damaging Het
Slc4a10 G A 2: 62,083,710 (GRCm39) G388S probably damaging Het
Smtn G T 11: 3,479,530 (GRCm39) N512K probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sspo A G 6: 48,455,258 (GRCm39) Y3040C probably damaging Het
Stat1 T A 1: 52,183,401 (GRCm39) V389E probably damaging Het
Sult5a1 A T 8: 123,872,161 (GRCm39) M227K probably damaging Het
Thsd4 T C 9: 59,964,325 (GRCm39) D389G probably damaging Het
Tnxb T C 17: 34,923,052 (GRCm39) V2545A possibly damaging Het
Tpo T A 12: 30,142,589 (GRCm39) I712F probably damaging Het
Trim62 T C 4: 128,803,204 (GRCm39) V418A probably damaging Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r66 T C 7: 84,657,093 (GRCm39) D104G probably benign Het
Wdr26 T C 1: 181,015,251 (GRCm39) I371V probably benign Het
Zfp273 T G 13: 67,974,298 (GRCm39) C475W probably damaging Het
Zfp738 G T 13: 67,821,182 (GRCm39) T55K probably damaging Het
Zmym2 A G 14: 57,183,971 (GRCm39) I978V probably benign Het
Other mutations in Pex5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Pex5l APN 3 33,006,746 (GRCm39) missense probably damaging 1.00
IGL01621:Pex5l APN 3 33,069,110 (GRCm39) splice site probably null
IGL01813:Pex5l APN 3 33,136,204 (GRCm39) missense probably benign 0.02
IGL02313:Pex5l APN 3 33,047,141 (GRCm39) missense probably benign 0.22
IGL02508:Pex5l APN 3 33,047,051 (GRCm39) splice site probably benign
IGL02997:Pex5l APN 3 33,009,991 (GRCm39) splice site probably benign
R0195:Pex5l UTSW 3 33,047,102 (GRCm39) missense possibly damaging 0.87
R0674:Pex5l UTSW 3 33,006,765 (GRCm39) missense probably damaging 1.00
R0729:Pex5l UTSW 3 33,008,685 (GRCm39) splice site probably benign
R1500:Pex5l UTSW 3 33,069,129 (GRCm39) missense probably damaging 1.00
R1513:Pex5l UTSW 3 33,069,162 (GRCm39) nonsense probably null
R1695:Pex5l UTSW 3 33,008,531 (GRCm39) missense probably benign 0.28
R1850:Pex5l UTSW 3 33,005,025 (GRCm39) splice site probably null
R2165:Pex5l UTSW 3 33,007,281 (GRCm39) splice site probably null
R2679:Pex5l UTSW 3 33,136,201 (GRCm39) missense probably benign 0.02
R2880:Pex5l UTSW 3 33,047,152 (GRCm39) critical splice acceptor site probably null
R2881:Pex5l UTSW 3 33,047,152 (GRCm39) critical splice acceptor site probably null
R3766:Pex5l UTSW 3 33,061,327 (GRCm39) missense probably benign 0.01
R3780:Pex5l UTSW 3 33,004,993 (GRCm39) missense probably damaging 1.00
R3934:Pex5l UTSW 3 33,061,321 (GRCm39) missense probably damaging 1.00
R3975:Pex5l UTSW 3 33,069,164 (GRCm39) missense probably damaging 0.99
R4285:Pex5l UTSW 3 33,061,336 (GRCm39) missense probably damaging 1.00
R4825:Pex5l UTSW 3 33,047,134 (GRCm39) missense probably damaging 0.99
R4855:Pex5l UTSW 3 33,196,989 (GRCm39) splice site probably benign
R4868:Pex5l UTSW 3 33,006,639 (GRCm39) missense probably damaging 1.00
R5135:Pex5l UTSW 3 33,009,980 (GRCm39) missense probably damaging 1.00
R5217:Pex5l UTSW 3 33,061,477 (GRCm39) splice site probably null
R5362:Pex5l UTSW 3 33,047,065 (GRCm39) missense probably damaging 1.00
R5398:Pex5l UTSW 3 33,006,639 (GRCm39) missense probably damaging 1.00
R5829:Pex5l UTSW 3 33,060,139 (GRCm39) missense probably benign 0.00
R6731:Pex5l UTSW 3 33,012,947 (GRCm39) missense probably damaging 1.00
R7180:Pex5l UTSW 3 33,078,840 (GRCm39) splice site probably null
R7452:Pex5l UTSW 3 33,058,467 (GRCm39) missense probably benign 0.02
R7549:Pex5l UTSW 3 33,136,184 (GRCm39) missense probably benign 0.04
R7563:Pex5l UTSW 3 33,008,625 (GRCm39) missense probably damaging 0.98
R7757:Pex5l UTSW 3 33,136,300 (GRCm39) start gained probably benign
R8030:Pex5l UTSW 3 33,008,568 (GRCm39) missense possibly damaging 0.93
R8143:Pex5l UTSW 3 33,136,658 (GRCm39) start gained probably benign
R8242:Pex5l UTSW 3 33,060,184 (GRCm39) missense probably benign 0.01
R8919:Pex5l UTSW 3 33,007,333 (GRCm39) missense probably damaging 1.00
R9034:Pex5l UTSW 3 33,006,683 (GRCm39) missense probably damaging 0.99
R9422:Pex5l UTSW 3 33,136,401 (GRCm39) start gained probably benign
R9585:Pex5l UTSW 3 33,060,091 (GRCm39) missense probably benign
R9654:Pex5l UTSW 3 33,010,827 (GRCm39) missense probably benign 0.08
R9711:Pex5l UTSW 3 33,136,204 (GRCm39) missense probably benign 0.02
Z1177:Pex5l UTSW 3 33,061,308 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGCGACCCATTTCCCATC -3'
(R):5'- AAGATTCTCGTGCTGCTGAGC -3'

Sequencing Primer
(F):5'- GAGCGACCCATTTCCCATCAATTAC -3'
(R):5'- TCGTGCTGCTGAGCCTCTG -3'
Posted On 2016-07-22