Incidental Mutation 'R8068:Ces2e'
ID 620110
Institutional Source Beutler Lab
Gene Symbol Ces2e
Ensembl Gene ENSMUSG00000031886
Gene Name carboxylesterase 2E
Synonyms 9030624L02Rik, Ces5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8068 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 104926260-104934672 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 104932997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034355] [ENSMUST00000034355] [ENSMUST00000034355] [ENSMUST00000109410]
AlphaFold Q8BK48
Predicted Effect probably null
Transcript: ENSMUST00000034355
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034355
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034355
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109410
SMART Domains Protein: ENSMUSP00000105037
Gene: ENSMUSG00000031886

DomainStartEndE-ValueType
Pfam:COesterase 9 538 1.7e-171 PFAM
Pfam:Abhydrolase_3 143 246 6.6e-11 PFAM
Pfam:Peptidase_S9 158 276 2.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Ces2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Ces2e APN 8 104929565 missense probably benign 0.42
IGL02045:Ces2e APN 8 104930658 splice site probably benign
IGL02656:Ces2e APN 8 104927056 missense possibly damaging 0.94
IGL02904:Ces2e APN 8 104931338 missense probably benign
IGL02972:Ces2e APN 8 104927061 missense probably damaging 1.00
IGL03244:Ces2e APN 8 104928819 missense probably benign 0.38
R0585:Ces2e UTSW 8 104929821 missense probably damaging 1.00
R0762:Ces2e UTSW 8 104929864 missense probably damaging 0.98
R1004:Ces2e UTSW 8 104929738 missense probably damaging 1.00
R1168:Ces2e UTSW 8 104927014 missense possibly damaging 0.49
R1731:Ces2e UTSW 8 104929576 missense probably damaging 1.00
R2134:Ces2e UTSW 8 104932539 critical splice donor site probably null
R3087:Ces2e UTSW 8 104930715 missense probably benign 0.18
R3693:Ces2e UTSW 8 104928811 missense probably damaging 1.00
R4622:Ces2e UTSW 8 104928709 splice site probably null
R4873:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4875:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4965:Ces2e UTSW 8 104933698 missense probably benign 0.09
R5365:Ces2e UTSW 8 104927214 critical splice donor site probably null
R5529:Ces2e UTSW 8 104929911 missense probably benign 0.00
R5601:Ces2e UTSW 8 104929494 missense probably benign 0.42
R5968:Ces2e UTSW 8 104932995 missense probably damaging 1.00
R6128:Ces2e UTSW 8 104928796 missense probably benign 0.03
R7337:Ces2e UTSW 8 104931056 splice site probably null
R7363:Ces2e UTSW 8 104933000 splice site probably null
R7489:Ces2e UTSW 8 104929780 missense probably benign 0.26
R7548:Ces2e UTSW 8 104931906 missense probably benign
R9426:Ces2e UTSW 8 104929588 missense probably damaging 1.00
Z1088:Ces2e UTSW 8 104931347 missense probably benign
Z1088:Ces2e UTSW 8 104932398 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGGGTGATAGCTAGCTG -3'
(R):5'- AAGTTAGCACAAGATGACCAGTAAC -3'

Sequencing Primer
(F):5'- CCTGGGTGATAGCTAGCTGACTTG -3'
(R):5'- ATATAAAGTGTCTAAGTGTGCTGTGC -3'
Posted On 2020-01-23