Incidental Mutation 'R8077:Gbp5'
ID629063
Institutional Source Beutler Lab
Gene Symbol Gbp5
Ensembl Gene ENSMUSG00000105504
Gene Nameguanylate binding protein 5
Synonyms5330409J06Rik, Gbp5a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location142493978-142522344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 142507739 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 472 (R472H)
Ref Sequence ENSEMBL: ENSMUSP00000087587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090127] [ENSMUST00000196255] [ENSMUST00000197459]
Predicted Effect probably benign
Transcript: ENSMUST00000090127
AA Change: R472H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000087587
Gene: ENSMUSG00000105504
AA Change: R472H

DomainStartEndE-ValueType
Pfam:GBP 18 281 4e-113 PFAM
Pfam:GBP_C 283 575 6e-109 PFAM
low complexity region 579 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196255
AA Change: R472H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143336
Gene: ENSMUSG00000105504
AA Change: R472H

DomainStartEndE-ValueType
Pfam:GBP 18 281 2.8e-113 PFAM
Pfam:GBP_C 283 556 5.5e-106 PFAM
internal_repeat_1 579 640 3.01e-21 PROSPERO
internal_repeat_1 647 708 3.01e-21 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000197459
AA Change: R360H
SMART Domains Protein: ENSMUSP00000142938
Gene: ENSMUSG00000105504
AA Change: R360H

DomainStartEndE-ValueType
Pfam:GBP 18 65 4.7e-16 PFAM
Pfam:GBP 63 169 4.8e-33 PFAM
Pfam:GBP_C 171 444 9.3e-104 PFAM
internal_repeat_1 467 528 5.89e-22 PROSPERO
internal_repeat_1 535 596 5.89e-22 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The encoded protein acts as an activator of NLRP3 inflammasome assembly and has a role in innate immunity and inflammation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Listeria infection and NLRP3 inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Gbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Gbp5 APN 3 142500594 missense probably damaging 1.00
IGL01625:Gbp5 APN 3 142503028 missense probably damaging 0.98
IGL02294:Gbp5 APN 3 142503827 missense probably damaging 1.00
PIT4362001:Gbp5 UTSW 3 142500710 missense probably damaging 1.00
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0166:Gbp5 UTSW 3 142506919 critical splice donor site probably null
R0357:Gbp5 UTSW 3 142505411 missense probably benign 0.05
R0414:Gbp5 UTSW 3 142507913 critical splice acceptor site probably null
R0457:Gbp5 UTSW 3 142507757 missense probably damaging 1.00
R0959:Gbp5 UTSW 3 142503124 missense possibly damaging 0.47
R1520:Gbp5 UTSW 3 142508014 missense probably damaging 0.97
R2143:Gbp5 UTSW 3 142503832 missense probably damaging 1.00
R2369:Gbp5 UTSW 3 142500719 missense possibly damaging 0.54
R3155:Gbp5 UTSW 3 142503127 critical splice donor site probably null
R4602:Gbp5 UTSW 3 142503785 missense probably benign 0.06
R4770:Gbp5 UTSW 3 142508076 missense possibly damaging 0.75
R5096:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R5605:Gbp5 UTSW 3 142501276 missense probably damaging 1.00
R7066:Gbp5 UTSW 3 142507729 missense probably benign 0.00
R7234:Gbp5 UTSW 3 142521137 missense probably benign 0.00
R7237:Gbp5 UTSW 3 142507700 missense probably benign 0.41
R7258:Gbp5 UTSW 3 142506781 missense probably damaging 1.00
R7475:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R7521:Gbp5 UTSW 3 142500621 missense probably benign 0.06
R7627:Gbp5 UTSW 3 142500558 start codon destroyed probably null 1.00
R7788:Gbp5 UTSW 3 142503080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTACTGGCTGAGCATCC -3'
(R):5'- CGAATAGCCTCCAACCTCTG -3'

Sequencing Primer
(F):5'- CCCAGGTTGCAAATTAGC -3'
(R):5'- CTTGTTCCGCTGAAGAAAAGC -3'
Posted On2020-06-30