Mutagenetix > Incidental Mutation

Incidental Mutation 'R8077:Slc23a2'

629061

Institutional Source

Beutler Lab

Gene Symbol

Slc23a2

Ensembl Gene

ENSMUSG00000027340

Gene Name

solute carrier family 23 (nucleobase transporters), member 2

Synonyms

Slc23a1, SVCT2, YSPL3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

132052496-132145108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 132089172 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 136 (A136S)

Ref Sequence

ENSEMBL: ENSMUSP00000028815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028815]

AlphaFold

Q9EPR4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028815
AA Change: A136S

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028815
Gene: ENSMUSG00000027340
AA Change: A136S

Domain	Start	End	E-Value	Type
Pfam:Xan_ur_permease	101	534	1.7e-93	PFAM
transmembrane domain	547	566	N/A	INTRINSIC
low complexity region	578	592	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 95.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within minutes of birth from respiratory distress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,517,237	V132E	probably benign	Het
4930563M21Rik	C	T	9: 55,987,966	V315M	probably damaging	Het
9430007A20Rik	T	C	4: 144,528,556	I182T	probably benign	Het
Alb	G	C	5: 90,467,355	R242P	probably damaging	Het
Amotl1	A	T	9: 14,550,502	V805D	probably damaging	Het
Arhgef3	T	C	14: 27,385,924	L179P	probably damaging	Het
Atp8b3	G	A	10: 80,531,024	L247F	possibly damaging	Het
Ccdc191	T	C	16: 43,915,605		probably null	Het
Celsr3	A	G	9: 108,828,331	H671R	probably benign	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap97	G	T	8: 46,170,445	V291F	possibly damaging	Het
Clca2	A	G	3: 145,071,527	V861A	possibly damaging	Het
Cln8	A	T	8: 14,894,950	D88V	probably damaging	Het
Col18a1	C	A	10: 77,080,851	G330V	unknown	Het
Dis3	C	T	14: 99,090,035	R344Q	probably benign	Het
Esyt2	T	A	12: 116,342,228	S359R	possibly damaging	Het
Fbxo41	A	T	6: 85,473,229	L844Q	probably damaging	Het
Fn1	G	A	1: 71,612,602	T1372M	probably damaging	Het
Gbp5	G	A	3: 142,507,739	R472H	probably benign	Het
Gm156	A	G	6: 129,766,695	Y209H	probably benign	Het
Gm21964	C	T	8: 110,110,103	T207M	probably damaging	Het
Gm4559	C	T	7: 142,273,816	R183K	unknown	Het
Gm9507	T	A	10: 77,811,770	E25V	unknown	Het
Gm9573	TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG	TCAGTGGTGGTCAGG	17: 35,619,736		probably benign	Het
Golgb1	A	G	16: 36,918,633	I2486V	probably damaging	Het
Ifitm10	A	T	7: 142,370,967	V45D	probably damaging	Het
Ift80	A	G	3: 68,916,145	Y595H	probably benign	Het
Itga8	C	T	2: 12,242,433	V326I	probably benign	Het
Kif14	A	T	1: 136,471,448	H449L	possibly damaging	Het
Ldlrad1	G	A	4: 107,209,491	A8T	probably benign	Het
Lrrc8b	C	A	5: 105,480,017	S76R	possibly damaging	Het
Lrrn1	T	C	6: 107,568,822	L527P	probably damaging	Het
Luc7l	T	C	17: 26,255,073	V35A	probably damaging	Het
Luzp1	T	G	4: 136,543,091	V875G	probably damaging	Het
Mcf2l	G	T	8: 12,998,494		probably null	Het
Mcoln2	T	C	3: 146,190,414	M497T	probably damaging	Het
Mrgprb4	A	T	7: 48,198,455	S242T	probably benign	Het
Nipbl	T	A	15: 8,311,250	R1995S	possibly damaging	Het
Nup35	A	G	2: 80,638,936		probably null	Het
Olfr1394	A	G	11: 49,160,485	D157G	probably damaging	Het
Olfr420	A	G	1: 174,151,845		probably benign	Het
Olfr45	C	T	7: 140,691,133	S76F	probably benign	Het
Prdm12	A	G	2: 31,642,304	K109E	probably damaging	Het
Ptch1	A	T	13: 63,540,812	L444Q	probably damaging	Het
Qtrt1	C	T	9: 21,420,096	R374*	probably null	Het
Rnase11	T	C	14: 51,049,941	D52G	probably damaging	Het
Rps6	A	G	4: 86,855,921	S148P	probably benign	Het
Rrm2b	T	C	15: 37,946,800	K86E	possibly damaging	Het
Sh2d1b2	A	G	1: 170,248,173	K59E	possibly damaging	Het
Six6	T	A	12: 72,940,326	W91R	probably damaging	Het
Slc9a5	G	A	8: 105,359,380	R593H	probably damaging	Het
Smbd1	T	C	16: 32,810,434	M1V	probably null	Het
Ssbp4	T	C	8: 70,598,997	Y239C	probably damaging	Het
Stox1	T	C	10: 62,665,566	E405G	probably damaging	Het
Tmem192	A	G	8: 64,965,544	I194V	probably benign	Het
Tns3	A	T	11: 8,445,667	C1246S	probably damaging	Het
Ugt1a6a	A	T	1: 88,138,853	Q127L	probably benign	Het
Ush2a	A	G	1: 188,542,828	I1833V	probably benign	Het
Vmn2r66	A	T	7: 85,006,885	Y308N	probably benign	Het
Vti1a	T	G	19: 55,576,485	L191R	probably benign	Het
Zbtb38	A	T	9: 96,688,100	N310K	probably benign	Het

Other mutations in Slc23a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Slc23a2	APN	2	132101500	missense	probably benign	0.00
IGL01123:Slc23a2	APN	2	132056816	missense	probably benign	0.02
IGL03115:Slc23a2	APN	2	132091265	missense	probably damaging	1.00
R0352:Slc23a2	UTSW	2	132060796	missense	probably benign	0.03
R0446:Slc23a2	UTSW	2	132078433	missense	probably benign	0.06
R0499:Slc23a2	UTSW	2	132072017	missense	probably damaging	1.00
R1252:Slc23a2	UTSW	2	132062197	splice site	probably null
R1663:Slc23a2	UTSW	2	132065464	missense	probably damaging	1.00
R1768:Slc23a2	UTSW	2	132075641	missense	probably benign
R1914:Slc23a2	UTSW	2	132056766	missense	probably damaging	0.99
R2277:Slc23a2	UTSW	2	132091259	missense	possibly damaging	0.54
R2326:Slc23a2	UTSW	2	132094195	missense	possibly damaging	0.72
R2385:Slc23a2	UTSW	2	132089201	missense	probably benign	0.01
R4049:Slc23a2	UTSW	2	132060683	missense	probably benign	0.00
R4084:Slc23a2	UTSW	2	132091217	nonsense	probably null
R4497:Slc23a2	UTSW	2	132056782	nonsense	probably null
R4710:Slc23a2	UTSW	2	132056709	missense	probably benign
R4873:Slc23a2	UTSW	2	132056880	missense	possibly damaging	0.75
R4875:Slc23a2	UTSW	2	132056880	missense	possibly damaging	0.75
R5008:Slc23a2	UTSW	2	132101494	missense	probably damaging	0.99
R5164:Slc23a2	UTSW	2	132075450	intron	probably benign
R5236:Slc23a2	UTSW	2	132075584	missense	probably damaging	0.97
R6587:Slc23a2	UTSW	2	132078481	missense	possibly damaging	0.70
R6738:Slc23a2	UTSW	2	132078436	missense	probably benign	0.10
R6960:Slc23a2	UTSW	2	132091253	missense	probably damaging	1.00
R7000:Slc23a2	UTSW	2	132094203	missense	possibly damaging	0.93
R7062:Slc23a2	UTSW	2	132091269	missense	probably damaging	0.99
R7293:Slc23a2	UTSW	2	132089106	missense	probably benign	0.02
R7324:Slc23a2	UTSW	2	132089123	missense	probably damaging	1.00
R8794:Slc23a2	UTSW	2	132060709	missense	probably benign	0.01
R8839:Slc23a2	UTSW	2	132101472	splice site	silent
R8882:Slc23a2	UTSW	2	132091239	missense	possibly damaging	0.82
R9129:Slc23a2	UTSW	2	132078412	critical splice donor site	probably null
R9252:Slc23a2	UTSW	2	132071922	missense	probably damaging	1.00
R9597:Slc23a2	UTSW	2	132062178	missense	probably damaging	1.00
R9728:Slc23a2	UTSW	2	132058210	missense	probably damaging	1.00
X0011:Slc23a2	UTSW	2	132091263	missense	possibly damaging	0.64
X0018:Slc23a2	UTSW	2	132066806	missense	probably benign	0.30
Z1176:Slc23a2	UTSW	2	132060788	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AATGGCCACTGGGATATGCTG -3'
(R):5'- AACTCGCGTAACTAGAGCG -3'

Sequencing Primer
(F):5'- TGGGATATGCTGTACCACCAACTG -3'
(R):5'- CGCGTAACTAGAGCGTCTTCATG -3'

Posted On

2020-06-30