Incidental Mutation 'R8077:Alb'
ID629070
Institutional Source Beutler Lab
Gene Symbol Alb
Ensembl Gene ENSMUSG00000029368
Gene Namealbumin
SynonymsAlb1, Alb-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R8077 (G1)
Quality Score192.009
Status Validated
Chromosome5
Chromosomal Location90460897-90476602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 90467355 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 242 (R242P)
Ref Sequence ENSEMBL: ENSMUSP00000031314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031314]
Predicted Effect probably damaging
Transcript: ENSMUST00000031314
AA Change: R242P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031314
Gene: ENSMUSG00000029368
AA Change: R242P

DomainStartEndE-ValueType
ALBUMIN 20 205 1.54e-84 SMART
ALBUMIN 212 397 3.43e-82 SMART
ALBUMIN 404 595 1.51e-83 SMART
Meta Mutation Damage Score 0.8571 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes albumin, an abundant plasma protein essential for maintaining oncotic pressure that functions as a carrier protein for various molecules such as steriods and fatty acids in blood. This gene is primarily expressed in liver where the encoded protein undergoes proteolytic processing before secretion into the plasma. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a TALEN-mediated deletion exhibit analbuminemia but appear healthy and grossly normal and breed normally. Mice heterozygotes for an ENU-induced point mutation have significantly reduced plasma albumin and calcium levels and significantly elevated alkaline phosphatase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Alb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Alb APN 5 90472073 missense probably benign 0.00
IGL01508:Alb APN 5 90470838 missense probably benign 0.19
IGL01722:Alb APN 5 90470839 critical splice donor site probably null
IGL02103:Alb APN 5 90464131 missense probably benign 0.00
IGL02379:Alb APN 5 90465879 missense probably benign 0.00
IGL02531:Alb APN 5 90467448 missense probably damaging 1.00
IGL02704:Alb APN 5 90468509 missense possibly damaging 0.82
IGL02828:Alb APN 5 90467388 missense probably benign 0.17
IGL03248:Alb APN 5 90461714 splice site probably benign
R0714:Alb UTSW 5 90462806 missense possibly damaging 0.81
R1418:Alb UTSW 5 90464202 splice site probably benign
R1708:Alb UTSW 5 90464051 missense possibly damaging 0.73
R2092:Alb UTSW 5 90463983 frame shift probably null
R4473:Alb UTSW 5 90464053 missense probably damaging 1.00
R4670:Alb UTSW 5 90462806 missense probably benign 0.00
R4758:Alb UTSW 5 90468593 missense probably benign 0.00
R5583:Alb UTSW 5 90468593 missense probably benign 0.00
R6384:Alb UTSW 5 90472640 missense possibly damaging 0.67
R7268:Alb UTSW 5 90462716 missense probably benign 0.15
R7295:Alb UTSW 5 90462834 critical splice donor site probably null
R7320:Alb UTSW 5 90464987 critical splice donor site probably null
R7337:Alb UTSW 5 90474593 missense probably damaging 1.00
R7505:Alb UTSW 5 90469509 missense probably damaging 1.00
R7575:Alb UTSW 5 90465929 missense probably damaging 1.00
R7651:Alb UTSW 5 90467355 missense probably damaging 1.00
R7652:Alb UTSW 5 90467355 missense probably damaging 1.00
R7654:Alb UTSW 5 90467355 missense probably damaging 1.00
R7669:Alb UTSW 5 90463991 missense possibly damaging 0.93
R7870:Alb UTSW 5 90472629 missense possibly damaging 0.96
R7879:Alb UTSW 5 90472648 missense probably benign 0.21
R7950:Alb UTSW 5 90472464 missense probably damaging 0.99
R7978:Alb UTSW 5 90472073 missense possibly damaging 0.77
R8078:Alb UTSW 5 90467355 missense probably damaging 1.00
R8316:Alb UTSW 5 90468590 missense probably benign 0.20
Z1177:Alb UTSW 5 90468512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCGCCATTCATTTAGTAG -3'
(R):5'- GTTCTCCGATGAAGCCAAACAC -3'

Sequencing Primer
(F):5'- TGCCAGATTAGCATTACAAGAAC -3'
(R):5'- CACAGGCGCTCAACTGAG -3'
Posted On2020-06-30