Incidental Mutation 'R8082:Polr3b'
ID 629426
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84656063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 362 (L362P)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably damaging
Transcript: ENSMUST00000077175
AA Change: L362P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: L362P

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,142,121 probably null Het
4921524J17Rik G A 8: 85,409,839 A133V possibly damaging Het
AI314180 G A 4: 58,807,852 A1672V probably benign Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Ankrd34c C A 9: 89,728,715 K524N probably damaging Het
Bicd2 C T 13: 49,379,053 Q372* probably null Het
Cadps2 T A 6: 23,323,314 M1002L probably damaging Het
Calcrl T C 2: 84,370,442 Y86C possibly damaging Het
Ccdc141 T C 2: 77,124,244 I220V probably damaging Het
Cep152 T C 2: 125,586,393 T773A probably benign Het
Cgn A G 3: 94,763,061 F1029L probably benign Het
Cntnap5b T A 1: 100,379,216 M515K probably benign Het
Col6a6 T A 9: 105,783,930 K327* probably null Het
Cspg4 A G 9: 56,885,893 Y304C probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
E130309D02Rik T C 5: 143,311,852 R147G probably benign Het
Emilin3 A C 2: 160,908,146 V561G probably damaging Het
Fam3c T A 6: 22,343,304 D12V unknown Het
Fam83f T C 15: 80,689,918 V158A probably damaging Het
Fgfbp1 T C 5: 43,979,279 R224G probably damaging Het
Gid4 A G 11: 60,436,447 K153E probably damaging Het
Gm13178 A C 4: 144,715,327 F118C probably damaging Het
Gm597 T A 1: 28,777,498 K484N probably benign Het
Hic2 A G 16: 17,258,699 H464R probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Ilvbl C T 10: 78,584,153 R602C probably damaging Het
Izumo1r T A 9: 14,894,077 D171V unknown Het
Kel T A 6: 41,703,490 E12V possibly damaging Het
Klf15 T C 6: 90,466,484 S14P possibly damaging Het
Lars T A 18: 42,244,910 S147C probably damaging Het
Lgals1 C T 15: 78,930,101 A122V probably benign Het
Lgsn C T 1: 31,204,192 H452Y probably benign Het
Lrrc37a T A 11: 103,457,422 I2816F unknown Het
Mcoln1 T A 8: 3,507,420 I142K probably benign Het
Met G A 6: 17,492,313 R358Q probably damaging Het
Mink1 T A 11: 70,613,277 C1276S possibly damaging Het
Mrc1 T C 2: 14,248,960 M264T probably benign Het
Mtfr2 C T 10: 20,353,389 T81M probably benign Het
Myo5c G A 9: 75,275,511 A811T possibly damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Ndufs3 T C 2: 90,894,864 D213G probably damaging Het
Olfr1009 T C 2: 85,721,480 V25A probably benign Het
Olfr1014 T A 2: 85,776,700 L39I probably benign Het
Olfr202 T C 16: 59,284,387 T37A possibly damaging Het
Olfr639 T A 7: 104,012,690 E4V probably benign Het
Otog C T 7: 46,289,719 R2058C probably damaging Het
Pcdh10 A T 3: 45,381,744 K831M probably damaging Het
Polr1b A G 2: 129,115,732 D569G probably benign Het
Rims2 G T 15: 39,476,523 R871L probably benign Het
Shprh T A 10: 11,151,811 I54N probably benign Het
Sipa1l2 T C 8: 125,491,809 D263G possibly damaging Het
Slc43a1 C T 2: 84,856,900 R382C probably benign Het
Sorbs1 T C 19: 40,365,083 R193G probably benign Het
Sry T A Y: 2,662,589 Q357L unknown Het
Taar8b T A 10: 24,091,891 D135V possibly damaging Het
Tekt3 T G 11: 63,070,230 V75G probably benign Het
Tm7sf2 A G 19: 6,066,321 L198P probably damaging Het
Tuba1a C T 15: 98,950,861 V177I probably benign Het
Wdr60 T A 12: 116,213,507 probably null Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCTTTTCTCGAGGCAC -3'
(R):5'- GGGGTAAACATCTCAACACAAG -3'

Sequencing Primer
(F):5'- CTCGAGGCACTTTAATTTAGGATAC -3'
(R):5'- GATTGGGATGTGGTCATATC -3'
Posted On 2020-06-30