Incidental Mutation 'R8166:Fam189a1'
ID633777
Institutional Source Beutler Lab
Gene Symbol Fam189a1
Ensembl Gene ENSMUSG00000030518
Gene Namefamily with sequence similarity 189, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8166 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64756091-65156570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64759405 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 414 (S414P)
Ref Sequence ENSEMBL: ENSMUSP00000113680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119118]
Predicted Effect probably benign
Transcript: ENSMUST00000119118
AA Change: S414P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113680
Gene: ENSMUSG00000030518
AA Change: S414P

DomainStartEndE-ValueType
Pfam:CD20 34 199 4.9e-33 PFAM
low complexity region 243 259 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,309,107 Y101N Het
Acad9 T C 3: 36,090,083 V569A probably benign Het
Actrt3 A G 3: 30,598,525 F140S probably damaging Het
AI607873 C A 1: 173,729,600 C524F possibly damaging Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Alx1 T A 10: 103,009,363 Q269L probably damaging Het
Amph G T 13: 18,948,490 A20S possibly damaging Het
Aqr T A 2: 114,113,325 M1111L possibly damaging Het
Atp10a A T 7: 58,807,522 H923L possibly damaging Het
Bmpr1a A C 14: 34,425,069 W249G probably damaging Het
Bmpr2 A T 1: 59,867,581 N611I probably damaging Het
Cadm2 A G 16: 66,953,309 L9S probably benign Het
Ccdc102a C A 8: 94,913,316 A117S possibly damaging Het
Clec4f G T 6: 83,652,642 S311R possibly damaging Het
Dchs2 T A 3: 83,354,333 I2636N probably benign Het
Dync2h1 T A 9: 7,129,089 K1809* probably null Het
Efs C T 14: 54,920,620 R108Q probably damaging Het
Eif5b A G 1: 38,048,820 T966A probably benign Het
Flnc A C 6: 29,433,732 N92H probably damaging Het
Gm13030 A T 4: 138,871,222 L130H unknown Het
Gm17190 A C 13: 96,082,634 R159S unknown Het
Hipk1 T C 3: 103,778,173 Y42C possibly damaging Het
Ighv8-9 G T 12: 115,468,592 P33H probably damaging Het
Igkv8-34 A G 6: 70,044,635 V15A probably benign Het
Irx5 T A 8: 92,360,084 probably null Het
Kcnh4 A G 11: 100,741,886 L925P probably benign Het
Kctd9 G A 14: 67,729,692 R153H possibly damaging Het
Lats1 A G 10: 7,702,116 T335A probably benign Het
Med20 A G 17: 47,613,102 T52A probably benign Het
Msantd4 A T 9: 4,384,095 T139S possibly damaging Het
Mtif3 T C 5: 146,959,242 T12A probably benign Het
N4bp2 T G 5: 65,820,312 S1518A probably benign Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nasp A T 4: 116,610,915 V291E probably benign Het
Ncapg2 T G 12: 116,412,416 D40E probably benign Het
Nipsnap1 A G 11: 4,884,057 D103G probably benign Het
Nsmce1 A G 7: 125,471,147 L164P probably damaging Het
Ogdhl G A 14: 32,337,806 V426I probably damaging Het
Olfr490 A G 7: 108,286,697 V143A probably benign Het
P3h2 T C 16: 25,992,822 E217G possibly damaging Het
Pnpt1 A G 11: 29,156,875 I649V probably benign Het
Pum2 G A 12: 8,721,739 A361T possibly damaging Het
Rictor G A 15: 6,769,334 probably null Het
Rps6ka4 G A 19: 6,837,443 R264W possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall1 T C 8: 89,028,518 T1278A probably benign Het
Scg2 T A 1: 79,435,583 K434N possibly damaging Het
Suclg1 T A 6: 73,260,572 V100D probably damaging Het
Tarbp1 T G 8: 126,427,128 E1528D possibly damaging Het
Tcrg-C1 A G 13: 19,216,602 N167S Het
Tshz2 C A 2: 169,883,655 T57K probably benign Het
Ttc22 G A 4: 106,634,476 R229H probably damaging Het
Vcan A G 13: 89,692,736 V1563A probably benign Het
Vmn1r68 A T 7: 10,527,961 M70K probably benign Het
Vmn2r105 A T 17: 20,208,642 I724N probably benign Het
Vmn2r96 T C 17: 18,582,482 L26P probably damaging Het
Wdr72 G A 9: 74,213,328 S955N probably benign Het
Zfp518b C A 5: 38,674,495 A56S probably damaging Het
Other mutations in Fam189a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fam189a1 APN 7 64819842 missense probably damaging 1.00
IGL02567:Fam189a1 APN 7 64786731 missense possibly damaging 0.95
thick UTSW 7 64759368 nonsense probably null
R0612:Fam189a1 UTSW 7 64761801 missense probably benign 0.17
R0720:Fam189a1 UTSW 7 64819910 splice site probably benign
R1368:Fam189a1 UTSW 7 64819877 missense probably damaging 1.00
R1716:Fam189a1 UTSW 7 64776885 splice site probably null
R1840:Fam189a1 UTSW 7 64759195 missense probably benign 0.37
R1972:Fam189a1 UTSW 7 64775768 missense possibly damaging 0.91
R1973:Fam189a1 UTSW 7 64775768 missense possibly damaging 0.91
R2201:Fam189a1 UTSW 7 64759393 missense probably benign 0.01
R2230:Fam189a1 UTSW 7 64759222 missense probably damaging 0.97
R2232:Fam189a1 UTSW 7 64759222 missense probably damaging 0.97
R2340:Fam189a1 UTSW 7 64775817 missense probably benign 0.00
R4809:Fam189a1 UTSW 7 64776740 missense probably damaging 1.00
R4923:Fam189a1 UTSW 7 64767691 missense probably benign 0.00
R4928:Fam189a1 UTSW 7 64759368 nonsense probably null
R5556:Fam189a1 UTSW 7 64856209 missense probably damaging 1.00
R5852:Fam189a1 UTSW 7 64775831 missense probably damaging 1.00
R6169:Fam189a1 UTSW 7 64759399 missense probably benign 0.00
R7029:Fam189a1 UTSW 7 64759327 missense probably benign 0.00
R7455:Fam189a1 UTSW 7 64759413 missense probably benign 0.00
R7512:Fam189a1 UTSW 7 65156170 missense probably benign 0.23
R7896:Fam189a1 UTSW 7 64776809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGTCGCACCTCTGTAG -3'
(R):5'- AAATTCACGCCAGGCTGAC -3'

Sequencing Primer
(F):5'- GTGCGTGTTCCAAAAACTTAGCC -3'
(R):5'- GCTGACAGGAAATTAAGTGACCC -3'
Posted On2020-07-13