Incidental Mutation 'R8174:Rspry1'
ID 634233
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Name ring finger and SPRY domain containing 1
Synonyms 4930470D19Rik
MMRRC Submission 067599-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R8174 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 95328569-95386905 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95376450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 448 (L448Q)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]
AlphaFold Q8BVR6
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: L448Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: L448Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: L448Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212729
AA Change: L324Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 A G 7: 75,378,617 (GRCm39) N2090S possibly damaging Het
Asxl3 T C 18: 22,650,800 (GRCm39) S930P probably benign Het
Cachd1 T A 4: 100,823,466 (GRCm39) I506N probably damaging Het
Calm1 G T 12: 100,171,967 (GRCm39) V140L probably benign Het
Cdsn A T 17: 35,866,529 (GRCm39) K353* probably null Het
Cldn11 T C 3: 31,208,210 (GRCm39) V125A probably benign Het
Ddx60 G A 8: 62,470,284 (GRCm39) probably null Het
Dlg2 A G 7: 91,589,248 (GRCm39) I216V probably benign Het
Dnah5 A G 15: 28,311,279 (GRCm39) probably null Het
Dnajc28 G A 16: 91,413,795 (GRCm39) R150* probably null Het
Erap1 A T 13: 74,794,683 (GRCm39) Y114F probably benign Het
Gm14443 G A 2: 175,011,468 (GRCm39) P326L probably damaging Het
Gm2042 T A 12: 87,926,928 (GRCm39) L415Q probably damaging Het
Gm8797 T C 3: 5,816,094 (GRCm39) I44T probably benign Het
Matn2 C A 15: 34,422,555 (GRCm39) F547L probably benign Het
Mpc2 T A 1: 165,308,458 (GRCm39) probably null Het
Or5b12b A G 19: 12,861,268 (GRCm39) T8A probably benign Het
Or7d10 A C 9: 19,832,020 (GRCm39) T172P probably damaging Het
Pcnx4 T A 12: 72,603,687 (GRCm39) L536Q probably damaging Het
Phlpp2 G A 8: 110,595,321 (GRCm39) R24H unknown Het
Pkmyt1 A T 17: 23,952,813 (GRCm39) D123V probably damaging Het
Polg A T 7: 79,106,466 (GRCm39) M668K probably benign Het
Ppp1r12a G T 10: 108,107,598 (GRCm39) A974S probably benign Het
Ppp2r3d T C 9: 101,090,501 (GRCm39) probably benign Het
Rabl3 T C 16: 37,377,225 (GRCm39) Y61H probably damaging Het
Rap2a T A 14: 120,716,269 (GRCm39) I44N probably damaging Het
Rev3l T C 10: 39,735,111 (GRCm39) V2779A probably damaging Het
Rnf43 G T 11: 87,622,057 (GRCm39) R259L probably benign Het
Slc43a2 T G 11: 75,434,193 (GRCm39) probably null Het
Slc6a5 A G 7: 49,598,057 (GRCm39) I640M probably benign Het
Sp140l1 T G 1: 85,077,261 (GRCm39) S102R probably damaging Het
Srrm2 C T 17: 24,034,297 (GRCm39) P314S unknown Het
Strn4 C T 7: 16,562,733 (GRCm39) R291C probably damaging Het
Syt4 T A 18: 31,577,230 (GRCm39) R41S probably benign Het
Tfb1m T C 17: 3,569,855 (GRCm39) D337G probably benign Het
Togaram1 G T 12: 65,029,465 (GRCm39) D963Y possibly damaging Het
Tpsg1 T C 17: 25,591,564 (GRCm39) C55R probably damaging Het
Tram1l1 A G 3: 124,115,911 (GRCm39) K357R probably benign Het
Veph1 A G 3: 66,171,316 (GRCm39) I42T probably damaging Het
Vps13b C G 15: 35,709,456 (GRCm39) S1801* probably null Het
Zcwpw1 G A 5: 137,817,839 (GRCm39) probably null Het
Zfp266 G A 9: 20,418,110 (GRCm39) probably benign Het
Zmym5 T A 14: 57,031,918 (GRCm39) R397* probably null Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 95,349,608 (GRCm39) intron probably benign
IGL00158:Rspry1 APN 8 95,349,614 (GRCm39) start codon destroyed probably null 0.89
IGL01141:Rspry1 APN 8 95,376,483 (GRCm39) missense probably benign 0.00
IGL01860:Rspry1 APN 8 95,376,444 (GRCm39) missense probably benign 0.00
IGL02174:Rspry1 APN 8 95,359,768 (GRCm39) missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 95,380,884 (GRCm39) missense probably benign 0.42
IGL02926:Rspry1 APN 8 95,376,439 (GRCm39) missense probably damaging 1.00
IGL03366:Rspry1 APN 8 95,376,962 (GRCm39) missense probably benign 0.00
R0570:Rspry1 UTSW 8 95,356,420 (GRCm39) missense probably damaging 1.00
R1833:Rspry1 UTSW 8 95,362,116 (GRCm39) missense probably damaging 1.00
R1988:Rspry1 UTSW 8 95,358,682 (GRCm39) critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 95,349,735 (GRCm39) missense probably damaging 1.00
R3623:Rspry1 UTSW 8 95,376,405 (GRCm39) missense probably damaging 1.00
R3624:Rspry1 UTSW 8 95,376,405 (GRCm39) missense probably damaging 1.00
R4275:Rspry1 UTSW 8 95,376,389 (GRCm39) missense probably benign 0.00
R4888:Rspry1 UTSW 8 95,385,417 (GRCm39) missense probably benign 0.19
R5026:Rspry1 UTSW 8 95,376,931 (GRCm39) missense probably damaging 1.00
R5310:Rspry1 UTSW 8 95,349,813 (GRCm39) missense probably benign
R5374:Rspry1 UTSW 8 95,380,892 (GRCm39) missense probably benign 0.38
R5374:Rspry1 UTSW 8 95,349,636 (GRCm39) missense probably benign 0.00
R5387:Rspry1 UTSW 8 95,364,914 (GRCm39) missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 95,363,388 (GRCm39) splice site probably null
R5631:Rspry1 UTSW 8 95,355,706 (GRCm39) start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 95,363,239 (GRCm39) splice site probably null
R6065:Rspry1 UTSW 8 95,349,615 (GRCm39) start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 95,385,378 (GRCm39) missense probably damaging 1.00
R6276:Rspry1 UTSW 8 95,349,886 (GRCm39) missense probably damaging 1.00
R6821:Rspry1 UTSW 8 95,362,059 (GRCm39) nonsense probably null
R7390:Rspry1 UTSW 8 95,349,813 (GRCm39) missense probably benign
R7460:Rspry1 UTSW 8 95,376,963 (GRCm39) missense probably benign 0.00
R7644:Rspry1 UTSW 8 95,385,396 (GRCm39) missense probably benign 0.00
R7717:Rspry1 UTSW 8 95,349,750 (GRCm39) missense probably damaging 1.00
R7768:Rspry1 UTSW 8 95,356,469 (GRCm39) missense probably damaging 1.00
R7940:Rspry1 UTSW 8 95,349,635 (GRCm39) missense probably benign 0.22
R7978:Rspry1 UTSW 8 95,349,753 (GRCm39) missense probably damaging 0.98
R8087:Rspry1 UTSW 8 95,380,925 (GRCm39) missense probably benign 0.04
R8326:Rspry1 UTSW 8 95,366,217 (GRCm39) missense probably damaging 1.00
R8676:Rspry1 UTSW 8 95,358,747 (GRCm39) missense probably benign 0.01
R8715:Rspry1 UTSW 8 95,349,888 (GRCm39) missense probably damaging 0.98
R8869:Rspry1 UTSW 8 95,359,780 (GRCm39) missense probably damaging 0.97
R9253:Rspry1 UTSW 8 95,349,621 (GRCm39) missense probably damaging 1.00
R9281:Rspry1 UTSW 8 95,363,259 (GRCm39) missense probably damaging 1.00
R9699:Rspry1 UTSW 8 95,380,857 (GRCm39) missense probably benign 0.01
X0010:Rspry1 UTSW 8 95,356,429 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATGTCAGATAAGCTGCACAGG -3'
(R):5'- AATATCAAACCCTCGGGCATTGAG -3'

Sequencing Primer
(F):5'- GCAAAGATAAATGTGTTGAATGTGTG -3'
(R):5'- CTCGGGCATTGAGGTCAGATC -3'
Posted On 2020-07-13