Incidental Mutation 'R8174:Rspry1'
ID634233
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Namering finger and SPRY domain containing 1
Synonyms4930470D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R8174 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94601937-94660275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94649822 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 448 (L448Q)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: L448Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: L448Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: L448Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212729
AA Change: L324Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik T G 1: 85,099,540 S102R probably damaging Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Asxl3 T C 18: 22,517,743 S930P probably benign Het
Cachd1 T A 4: 100,966,269 I506N probably damaging Het
Calm1 G T 12: 100,205,708 V140L probably benign Het
Cdsn A T 17: 35,555,632 K353* probably null Het
Cldn11 T C 3: 31,154,061 V125A probably benign Het
Ddx60 G A 8: 62,017,250 probably null Het
Dlg2 A G 7: 91,940,040 I216V probably benign Het
Dnah5 A G 15: 28,311,133 probably null Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Erap1 A T 13: 74,646,564 Y114F probably benign Het
Fam179b G T 12: 64,982,691 D963Y possibly damaging Het
Gm14443 G A 2: 175,169,675 P326L probably damaging Het
Gm2042 T A 12: 87,960,158 L415Q probably damaging Het
Gm8797 T C 3: 5,751,034 I44T probably benign Het
Matn2 C A 15: 34,422,409 F547L probably benign Het
Mpc2 T A 1: 165,480,889 probably null Het
Olfr1445 A G 19: 12,883,904 T8A probably benign Het
Olfr77 A C 9: 19,920,724 T172P probably damaging Het
Pcnx4 T A 12: 72,556,913 L536Q probably damaging Het
Phlpp2 G A 8: 109,868,689 R24H unknown Het
Pkmyt1 A T 17: 23,733,839 D123V probably damaging Het
Polg A T 7: 79,456,718 M668K probably benign Het
Ppp1r12a G T 10: 108,271,737 A974S probably benign Het
Ppp2r3a T C 9: 101,213,302 probably benign Het
Rabl3 T C 16: 37,556,863 Y61H probably damaging Het
Rap2a T A 14: 120,478,857 I44N probably damaging Het
Rev3l T C 10: 39,859,115 V2779A probably damaging Het
Rnf43 G T 11: 87,731,231 R259L probably benign Het
Slc43a2 T G 11: 75,543,367 probably null Het
Slc6a5 A G 7: 49,948,309 I640M probably benign Het
Srrm2 C T 17: 23,815,323 P314S unknown Het
Strn4 C T 7: 16,828,808 R291C probably damaging Het
Syt4 T A 18: 31,444,177 R41S probably benign Het
Tfb1m T C 17: 3,519,580 D337G probably benign Het
Tpsg1 T C 17: 25,372,590 C55R probably damaging Het
Tram1l1 A G 3: 124,322,262 K357R probably benign Het
Veph1 A G 3: 66,263,895 I42T probably damaging Het
Vps13b C G 15: 35,709,310 S1801* probably null Het
Zcwpw1 G A 5: 137,819,577 probably null Het
Zfp266 G A 9: 20,506,814 probably benign Het
Zmym5 T A 14: 56,794,461 R397* probably null Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
R7940:Rspry1 UTSW 8 94623007 missense probably benign 0.22
R7978:Rspry1 UTSW 8 94623125 missense probably damaging 0.98
R8087:Rspry1 UTSW 8 94654297 missense probably benign 0.04
R8326:Rspry1 UTSW 8 94639589 missense probably damaging 1.00
R8676:Rspry1 UTSW 8 94632119 missense probably benign 0.01
R8715:Rspry1 UTSW 8 94623260 missense probably damaging 0.98
R8869:Rspry1 UTSW 8 94633152 missense probably damaging 0.97
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATGTCAGATAAGCTGCACAGG -3'
(R):5'- AATATCAAACCCTCGGGCATTGAG -3'

Sequencing Primer
(F):5'- GCAAAGATAAATGTGTTGAATGTGTG -3'
(R):5'- CTCGGGCATTGAGGTCAGATC -3'
Posted On2020-07-13