Mutagenetix > Incidental Mutation

Incidental Mutation 'R8242:Sntb1'

637620

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R8242 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55792233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 196 (A196T)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769] [ENSMUST00000110200]

AlphaFold

Q99L88

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039769
AA Change: A196T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: A196T

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110200
AA Change: A196T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105829
Gene: ENSMUSG00000060429
AA Change: A196T

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
PDZ	120	194	4.5e-17	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.2%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932411E22Rik	C	G	11: 89,526,445		probably null	Het
Adcy10	T	C	1: 165,546,549	Y736H	possibly damaging	Het
Akr1c12	G	A	13: 4,272,270	R258*	probably null	Het
Arfgef3	T	C	10: 18,630,076	K947E	probably benign	Het
Barx2	C	A	9: 31,912,931	R54L	probably damaging	Het
BC030500	T	C	8: 58,912,354	I13T	unknown	Het
Bcl11a	T	A	11: 24,163,208	F184I	probably benign	Het
Cfap43	A	G	19: 47,897,369	L269P	probably damaging	Het
Col8a1	G	T	16: 57,632,358	P94Q	possibly damaging	Het
Coq5	T	C	5: 115,279,747	V12A	probably benign	Het
Csmd1	A	G	8: 16,710,654	V155A	probably benign	Het
Defb22	A	C	2: 152,486,087	C59W	probably damaging	Het
Dsg3	A	G	18: 20,536,923	T665A	possibly damaging	Het
E430025E21Rik	A	G	15: 59,344,122	S803P	probably damaging	Het
Gm10542	A	G	18: 44,204,641	D62G	possibly damaging	Het
Gm14025	G	T	2: 129,039,393	C204*	probably null	Het
Gm5591	T	A	7: 38,520,322	T376S	probably benign	Het
Hps3	C	T	3: 20,014,126	R588H	possibly damaging	Het
Itpr1	A	T	6: 108,386,697	D760V	probably benign	Het
Mfsd8	G	A	3: 40,835,193	R140C	probably damaging	Het
Mroh2b	A	T	15: 4,909,040	R270S	probably benign	Het
Mroh4	G	T	15: 74,616,308	H350N	possibly damaging	Het
Olfr1055	A	T	2: 86,347,082	M228K	probably damaging	Het
Olfr1178	A	G	2: 88,392,074	I276V	possibly damaging	Het
Olfr525	T	A	7: 140,322,783	L28*	probably null	Het
Olfr560	T	C	7: 102,753,099	M277V	probably benign	Het
Pex5l	T	A	3: 33,006,035	T196S	probably benign	Het
Phlpp2	T	C	8: 109,940,202	V1121A	probably benign	Het
Rab3gap2	T	A	1: 185,221,853	S41T	probably benign	Het
Rad51c	A	T	11: 87,389,886	N293K	probably damaging	Het
Rgs3	C	A	4: 62,619,785	Q18K	probably benign	Het
Ripk2	C	T	4: 16,124,430	G426D	probably benign	Het
RP23-202K1.1	G	A	8: 27,548,793	S987N	unknown	Het
Rpl22l1	T	C	3: 28,806,765	V44A	possibly damaging	Het
Sorcs3	C	T	19: 48,206,474	R99W	possibly damaging	Het
Tdrd6	T	C	17: 43,628,930	E409G	probably damaging	Het
Timm50	A	T	7: 28,308,411	D105E	probably benign	Het
Tsga10	A	T	1: 37,807,101	S315T	probably benign	Het
Ttpa	G	A	4: 20,028,511	C256Y	probably damaging	Het
Vmn2r13	T	C	5: 109,175,006	Y139C	possibly damaging	Het
Wdr66	T	A	5: 123,273,851	D515E	possibly damaging	Het
Whsc1l1	G	T	8: 25,706,539	E1183*	probably null	Het
Zfp985	A	C	4: 147,584,182	K502N	possibly damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37
R9280:Sntb1	UTSW	15	55906375	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGTTTTCAGGGTCAGCCAAGG -3'
(R):5'- CATTCTTGCCTGGGTTTACAGAAC -3'

Sequencing Primer
(F):5'- GTCATGTTCCGGGTGACATAACAC -3'
(R):5'- TACAGAACCAGACTTGTGTTCC -3'

Posted On

2020-07-13