Incidental Mutation 'R8308:Ap2a2'
ID641192
Institutional Source Beutler Lab
Gene Symbol Ap2a2
Ensembl Gene ENSMUSG00000002957
Gene Nameadaptor-related protein complex 2, alpha 2 subunit
Synonymsalpha-C adaptin, alpha-adaptin C, 2410074K14Rik, Adtab, L25
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141562173-141633011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141630299 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 850 (V850A)
Ref Sequence ENSEMBL: ENSMUSP00000003038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
PDB Structure ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM CLATHRIN ADAPTOR AP2 [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH AMPHIPHYSIN FXDXF [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM THE AP2 ADAPTOR COMPLEX, BOUND TO 2 PEPTIDES FROM SYNAPTOJANIN170 [X-RAY DIFFRACTION]
AP2 CLATHRIN ADAPTOR CORE with Dileucine peptide RM(phosphoS)QIKRLLSE [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000003038
AA Change: V850A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957
AA Change: V850A

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062451
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190907
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP-2 adaptor protein complex, which is involved in linking lipid and protein membrane components with the clathrin lattice. This interaction supports the formation of clathrin-coated vesicles, and the encoded subunit aids in the process by binding polyphosphoinositide-containing lipids in the cell membrane. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Ap2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ap2a2 APN 7 141605019 splice site probably benign
IGL02664:Ap2a2 APN 7 141629223 missense probably benign 0.00
IGL02973:Ap2a2 APN 7 141631364 missense possibly damaging 0.63
IGL03366:Ap2a2 APN 7 141629273 missense probably benign
R0345:Ap2a2 UTSW 7 141631293 missense probably damaging 1.00
R2212:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R2904:Ap2a2 UTSW 7 141619478 missense probably damaging 0.98
R3412:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R3413:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R4962:Ap2a2 UTSW 7 141630148 missense probably damaging 1.00
R5602:Ap2a2 UTSW 7 141604942 missense probably benign
R5910:Ap2a2 UTSW 7 141598778 missense probably damaging 1.00
R6488:Ap2a2 UTSW 7 141602307 missense probably benign 0.02
R7003:Ap2a2 UTSW 7 141629196 missense probably benign
R7132:Ap2a2 UTSW 7 141619565 missense probably benign 0.32
R7140:Ap2a2 UTSW 7 141598864 missense probably benign 0.30
R7227:Ap2a2 UTSW 7 141620871 missense probably damaging 1.00
R7412:Ap2a2 UTSW 7 141626136 missense probably damaging 0.97
R7482:Ap2a2 UTSW 7 141602297 missense possibly damaging 0.46
R7632:Ap2a2 UTSW 7 141631323 missense probably benign 0.00
R7991:Ap2a2 UTSW 7 141609847 missense probably damaging 1.00
R8124:Ap2a2 UTSW 7 141598844 missense probably benign 0.05
R8271:Ap2a2 UTSW 7 141620899 missense probably damaging 1.00
R8462:Ap2a2 UTSW 7 141630481 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCCAGCCCACAGAAATGGC -3'
(R):5'- TGTGTATTATGCCAGCACCC -3'

Sequencing Primer
(F):5'- CCACAGAAATGGCTTCTCAGGATTTC -3'
(R):5'- CCCACGAAATTTGCAGGATTCGG -3'
Posted On2020-07-28