Incidental Mutation 'R8211:Bcl11a'
ID656338
Institutional Source Beutler Lab
Gene Symbol Bcl11a
Ensembl Gene ENSMUSG00000000861
Gene NameB cell CLL/lymphoma 11A (zinc finger protein)
Synonyms2810047E18Rik, Evi9c, Evi9, Evi9b, Evi9a, COUP-TF interacting protein 1, D930021L15Rik, CTIP1, mouse myeloid leukemia gene
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8211 (G1)
Quality Score53.0072
Status Validated
Chromosome11
Chromosomal Location24078056-24174123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24078394 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2 (S2T)
Ref Sequence ENSEMBL: ENSMUSP00000105140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000881] [ENSMUST00000068360] [ENSMUST00000109514] [ENSMUST00000109516] [ENSMUST00000118955]
Predicted Effect probably damaging
Transcript: ENSMUST00000000881
AA Change: S2T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000881
Gene: ENSMUSG00000000861
AA Change: S2T

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 5.9e-9 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068360
SMART Domains Protein: ENSMUSP00000063283
Gene: ENSMUSG00000055010

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109514
AA Change: S2T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105140
Gene: ENSMUSG00000000861
AA Change: S2T

DomainStartEndE-ValueType
Blast:ZnF_C2H2 46 72 8e-10 BLAST
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
ZnF_C2H2 742 764 1.41e0 SMART
ZnF_C2H2 770 792 4.24e-4 SMART
ZnF_C2H2 800 823 3.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109516
AA Change: S2T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105142
Gene: ENSMUSG00000000861
AA Change: S2T

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 3.2e-8 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118955
SMART Domains Protein: ENSMUSP00000112948
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
ZnF_C2H2 118 141 7.15e-2 SMART
Meta Mutation Damage Score 0.1618 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in B cell deficiency, alteration of T cell types, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Bcl11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Bcl11a APN 11 24163346 missense probably benign 0.00
IGL03190:Bcl11a APN 11 24158333 missense probably benign 0.00
R0317:Bcl11a UTSW 11 24172697 critical splice acceptor site probably null
R1061:Bcl11a UTSW 11 24164069 nonsense probably null
R1124:Bcl11a UTSW 11 24163928 missense probably damaging 1.00
R1163:Bcl11a UTSW 11 24165143 missense probably benign 0.41
R1498:Bcl11a UTSW 11 24164005 missense probably damaging 1.00
R1599:Bcl11a UTSW 11 24163887 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24163167 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24164406 missense possibly damaging 0.66
R1754:Bcl11a UTSW 11 24164724 missense probably damaging 1.00
R2036:Bcl11a UTSW 11 24164087 missense possibly damaging 0.71
R2207:Bcl11a UTSW 11 24163343 missense probably damaging 1.00
R3700:Bcl11a UTSW 11 24163890 missense probably damaging 1.00
R3779:Bcl11a UTSW 11 24164568 missense probably damaging 1.00
R4557:Bcl11a UTSW 11 24164004 missense probably damaging 1.00
R4703:Bcl11a UTSW 11 24163725 missense possibly damaging 0.80
R5006:Bcl11a UTSW 11 24164989 nonsense probably null
R5053:Bcl11a UTSW 11 24164068 missense probably benign 0.03
R5495:Bcl11a UTSW 11 24165042 missense possibly damaging 0.73
R5581:Bcl11a UTSW 11 24163932 missense probably damaging 1.00
R5680:Bcl11a UTSW 11 24164264 missense possibly damaging 0.52
R5790:Bcl11a UTSW 11 24163650 missense probably damaging 1.00
R6291:Bcl11a UTSW 11 24158321 missense probably damaging 0.96
R6723:Bcl11a UTSW 11 24163646 missense probably damaging 1.00
R7116:Bcl11a UTSW 11 24163839 missense probably damaging 1.00
R7274:Bcl11a UTSW 11 24163985 missense probably damaging 1.00
R7569:Bcl11a UTSW 11 24085458 nonsense probably null
R7843:Bcl11a UTSW 11 24164831 missense probably benign 0.26
R7923:Bcl11a UTSW 11 24163680 missense probably damaging 1.00
R7964:Bcl11a UTSW 11 24163353 missense probably benign 0.28
R8242:Bcl11a UTSW 11 24163208 missense probably benign 0.14
R8338:Bcl11a UTSW 11 24164578 missense probably damaging 1.00
R8478:Bcl11a UTSW 11 24165086 missense probably damaging 1.00
R8896:Bcl11a UTSW 11 24163640 missense probably benign 0.00
R8911:Bcl11a UTSW 11 24164763 missense probably damaging 1.00
Z1176:Bcl11a UTSW 11 24165010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGGCTCTCCCACAATTC -3'
(R):5'- ACACGGTTCATGTTTGAGAGG -3'

Sequencing Primer
(F):5'- ACAATTCATCTTCCCTGCGC -3'
(R):5'- ATGGGGGCTTTTTCCCTTTTTAATC -3'
Posted On2020-10-23