Incidental Mutation 'R8211:Zfp938'
ID636174
Institutional Source Beutler Lab
Gene Symbol Zfp938
Ensembl Gene ENSMUSG00000062931
Gene Namezinc finger protein 938
SynonymsB230315N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location82224850-82241280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82226585 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 67 (N67S)
Ref Sequence ENSEMBL: ENSMUSP00000047110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041264] [ENSMUST00000156218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041264
AA Change: N67S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047110
Gene: ENSMUSG00000062931
AA Change: N67S

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
ZnF_C2H2 161 188 2.82e1 SMART
ZnF_C2H2 267 289 1.23e0 SMART
ZnF_C2H2 295 317 2.91e-2 SMART
ZnF_C2H2 323 345 2.4e-3 SMART
ZnF_C2H2 351 373 7.26e-3 SMART
ZnF_C2H2 379 401 4.65e-1 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 5.59e-4 SMART
ZnF_C2H2 463 485 1.82e-3 SMART
ZnF_C2H2 491 513 3.63e-3 SMART
ZnF_C2H2 519 541 7.67e-2 SMART
ZnF_C2H2 547 569 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156218
SMART Domains Protein: ENSMUSP00000121613
Gene: ENSMUSG00000062931

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Other mutations in Zfp938
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Zfp938 APN 10 82227521 utr 3 prime probably benign
IGL00743:Zfp938 APN 10 82226483 missense probably benign
IGL01764:Zfp938 APN 10 82227790 splice site probably benign
IGL01814:Zfp938 APN 10 82226218 missense probably benign
IGL02244:Zfp938 APN 10 82226072 missense possibly damaging 0.86
IGL02865:Zfp938 APN 10 82226192 missense probably benign 0.33
R0372:Zfp938 UTSW 10 82227828 missense probably damaging 1.00
R0666:Zfp938 UTSW 10 82225772 missense probably damaging 1.00
R0964:Zfp938 UTSW 10 82225419 missense probably benign 0.00
R1453:Zfp938 UTSW 10 82227798 critical splice donor site probably null
R1672:Zfp938 UTSW 10 82225148 missense probably benign
R1929:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R1959:Zfp938 UTSW 10 82225631 missense probably damaging 1.00
R2127:Zfp938 UTSW 10 82226042 missense probably benign
R2271:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R2900:Zfp938 UTSW 10 82225506 missense possibly damaging 0.92
R4502:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4503:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4886:Zfp938 UTSW 10 82226123 missense probably benign 0.33
R4934:Zfp938 UTSW 10 82226178 missense possibly damaging 0.86
R5174:Zfp938 UTSW 10 82226004 missense possibly damaging 0.53
R5410:Zfp938 UTSW 10 82225258 missense possibly damaging 0.89
R6284:Zfp938 UTSW 10 82227566 missense possibly damaging 0.73
R6491:Zfp938 UTSW 10 82227529 makesense probably null
R6575:Zfp938 UTSW 10 82225326 nonsense probably null
R6649:Zfp938 UTSW 10 82225398 missense probably damaging 0.99
R7992:Zfp938 UTSW 10 82225943 missense possibly damaging 0.53
R8313:Zfp938 UTSW 10 82225588 missense possibly damaging 0.75
X0066:Zfp938 UTSW 10 82226097 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TACTGCTTGGCTCACATCC -3'
(R):5'- CAAATGAATCACAGGAAAGCTAGT -3'

Sequencing Primer
(F):5'- CATAAGGCTTTTCTCCAATGGG -3'
(R):5'- TCACAGGAAAGCTAGTGTTACTC -3'
Posted On2020-07-13