Incidental Mutation 'R8211:Ugt2b37'
ID636158
Institutional Source Beutler Lab
Gene Symbol Ugt2b37
Ensembl Gene ENSMUSG00000057425
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms0610033E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location87240493-87254804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87242376 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 404 (I404V)
Ref Sequence ENSEMBL: ENSMUSP00000075255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075858]
Predicted Effect probably benign
Transcript: ENSMUST00000075858
AA Change: I404V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075255
Gene: ENSMUSG00000057425
AA Change: I404V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 5.5e-256 PFAM
Pfam:Glyco_tran_28_C 328 449 2.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Ugt2b37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Ugt2b37 APN 5 87242481 missense possibly damaging 0.90
IGL00567:Ugt2b37 APN 5 87254074 missense probably damaging 1.00
IGL00787:Ugt2b37 APN 5 87242429 missense probably benign 0.00
IGL01560:Ugt2b37 APN 5 87251839 missense probably damaging 1.00
IGL01617:Ugt2b37 APN 5 87251879 missense probably damaging 1.00
IGL01982:Ugt2b37 APN 5 87242432 missense probably damaging 1.00
IGL02299:Ugt2b37 APN 5 87242315 missense probably benign 0.00
IGL02323:Ugt2b37 APN 5 87250564 splice site probably benign
IGL02326:Ugt2b37 APN 5 87241002 missense probably benign 0.25
IGL02516:Ugt2b37 APN 5 87240882 missense probably damaging 1.00
IGL03285:Ugt2b37 APN 5 87240875 missense probably damaging 1.00
R0076:Ugt2b37 UTSW 5 87254221 missense probably benign 0.31
R0141:Ugt2b37 UTSW 5 87240983 missense probably damaging 1.00
R0312:Ugt2b37 UTSW 5 87250665 missense probably damaging 1.00
R0359:Ugt2b37 UTSW 5 87250584 missense probably benign 0.10
R0523:Ugt2b37 UTSW 5 87251832 missense possibly damaging 0.91
R1938:Ugt2b37 UTSW 5 87240857 missense probably damaging 1.00
R1962:Ugt2b37 UTSW 5 87254334 missense probably damaging 1.00
R2496:Ugt2b37 UTSW 5 87254710 missense probably damaging 0.97
R3704:Ugt2b37 UTSW 5 87242987 missense possibly damaging 0.55
R4430:Ugt2b37 UTSW 5 87254092 missense probably benign 0.00
R4825:Ugt2b37 UTSW 5 87250639 missense possibly damaging 0.91
R5043:Ugt2b37 UTSW 5 87251860 nonsense probably null
R5098:Ugt2b37 UTSW 5 87242953 missense probably damaging 1.00
R5174:Ugt2b37 UTSW 5 87251880 missense probably benign 0.00
R5522:Ugt2b37 UTSW 5 87240900 missense probably benign 0.14
R5879:Ugt2b37 UTSW 5 87254406 missense probably benign
R5999:Ugt2b37 UTSW 5 87254177 missense probably benign 0.25
R6374:Ugt2b37 UTSW 5 87242420 missense probably damaging 1.00
R6454:Ugt2b37 UTSW 5 87240977 missense probably damaging 1.00
R6857:Ugt2b37 UTSW 5 87240846 missense probably damaging 0.98
R6875:Ugt2b37 UTSW 5 87242429 missense probably benign 0.00
R6916:Ugt2b37 UTSW 5 87254600 missense probably benign 0.07
R7099:Ugt2b37 UTSW 5 87240989 missense probably benign 0.00
R7239:Ugt2b37 UTSW 5 87254731 missense probably benign
R7470:Ugt2b37 UTSW 5 87254112 missense probably benign 0.24
R7810:Ugt2b37 UTSW 5 87254259 missense probably damaging 1.00
R7841:Ugt2b37 UTSW 5 87250630 missense probably benign 0.05
R7860:Ugt2b37 UTSW 5 87254330 missense probably damaging 1.00
R7861:Ugt2b37 UTSW 5 87242440 nonsense probably null
R8200:Ugt2b37 UTSW 5 87240891 nonsense probably null
R8282:Ugt2b37 UTSW 5 87254581 missense probably benign 0.01
R8312:Ugt2b37 UTSW 5 87242940 missense probably benign 0.15
R8520:Ugt2b37 UTSW 5 87240855 missense probably benign 0.04
R8688:Ugt2b37 UTSW 5 87242381 missense possibly damaging 0.52
R8695:Ugt2b37 UTSW 5 87242384 missense probably benign 0.00
R8772:Ugt2b37 UTSW 5 87254486 missense probably benign 0.00
R8839:Ugt2b37 UTSW 5 87254556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGGCTTTCAGTAAGAAGACAC -3'
(R):5'- TTAGATTCTTCTAGCTCTGAGACAGAG -3'

Sequencing Primer
(F):5'- TTCCTCCAGTGCATTGAG -3'
(R):5'- CTGAGACAGAGAAATATTTCAGTGAG -3'
Posted On2020-07-13