Incidental Mutation 'R8211:Snx19'
ID 636170
Institutional Source Beutler Lab
Gene Symbol Snx19
Ensembl Gene ENSMUSG00000031993
Gene Name sorting nexin 19
Synonyms 3526401K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8211 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 30427108-30466733 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30437465 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 798 (E798G)
Ref Sequence ENSEMBL: ENSMUSP00000131895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164099]
AlphaFold Q6P4T1
Predicted Effect probably benign
Transcript: ENSMUST00000164099
AA Change: E798G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: E798G

DomainStartEndE-ValueType
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:PXA 96 269 2.9e-43 PFAM
low complexity region 324 335 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 504 528 N/A INTRINSIC
PX 533 664 1.83e-24 SMART
Pfam:Nexin_C 843 951 1.9e-23 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Snx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Snx19 APN 9 30429084 missense possibly damaging 0.92
IGL00498:Snx19 APN 9 30428937 missense possibly damaging 0.92
IGL00718:Snx19 APN 9 30432326 missense probably damaging 1.00
IGL00902:Snx19 APN 9 30428732 missense possibly damaging 0.90
IGL01433:Snx19 APN 9 30428771 missense possibly damaging 0.93
IGL01668:Snx19 APN 9 30427823 missense probably benign
IGL01732:Snx19 APN 9 30462353 missense probably damaging 1.00
IGL01767:Snx19 APN 9 30463264 missense possibly damaging 0.95
IGL02638:Snx19 APN 9 30432364 missense possibly damaging 0.52
IGL02718:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02719:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02723:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02724:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02725:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02892:Snx19 APN 9 30428364 missense probably damaging 1.00
IGL03061:Snx19 APN 9 30433632 missense probably damaging 0.99
IGL03402:Snx19 APN 9 30440134 missense possibly damaging 0.89
R0125:Snx19 UTSW 9 30440219 missense probably damaging 1.00
R0133:Snx19 UTSW 9 30428616 missense possibly damaging 0.94
R0196:Snx19 UTSW 9 30433387 missense probably damaging 1.00
R0423:Snx19 UTSW 9 30435837 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428810 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428811 missense probably damaging 1.00
R1068:Snx19 UTSW 9 30429018 missense probably damaging 0.99
R1570:Snx19 UTSW 9 30428343 missense probably damaging 1.00
R1727:Snx19 UTSW 9 30433366 missense probably damaging 1.00
R1895:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1907:Snx19 UTSW 9 30433576 missense probably damaging 0.99
R1946:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1989:Snx19 UTSW 9 30428108 missense possibly damaging 0.93
R2029:Snx19 UTSW 9 30429000 missense probably benign 0.01
R2914:Snx19 UTSW 9 30433532 unclassified probably benign
R3880:Snx19 UTSW 9 30462392 missense probably damaging 1.00
R4223:Snx19 UTSW 9 30428448 missense possibly damaging 0.95
R4415:Snx19 UTSW 9 30437483 missense probably damaging 0.99
R4438:Snx19 UTSW 9 30428599 missense probably benign 0.01
R4484:Snx19 UTSW 9 30427896 missense probably benign 0.01
R4585:Snx19 UTSW 9 30440195 missense probably damaging 1.00
R4765:Snx19 UTSW 9 30440157 missense probably damaging 1.00
R4771:Snx19 UTSW 9 30433638 missense probably damaging 1.00
R4922:Snx19 UTSW 9 30437467 missense probably benign 0.25
R5096:Snx19 UTSW 9 30428786 missense probably benign 0.40
R5464:Snx19 UTSW 9 30427973 missense possibly damaging 0.54
R6469:Snx19 UTSW 9 30427743 missense possibly damaging 0.50
R6886:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R6988:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R7131:Snx19 UTSW 9 30427893 missense probably damaging 1.00
R7268:Snx19 UTSW 9 30440177 missense probably damaging 1.00
R7772:Snx19 UTSW 9 30428925 missense probably damaging 0.99
R8087:Snx19 UTSW 9 30464402 missense probably benign
R8283:Snx19 UTSW 9 30463226 missense possibly damaging 0.56
R9000:Snx19 UTSW 9 30464323 missense unknown
R9383:Snx19 UTSW 9 30435900 missense probably damaging 1.00
R9436:Snx19 UTSW 9 30463306 missense possibly damaging 0.55
X0019:Snx19 UTSW 9 30437366 missense probably damaging 1.00
X0024:Snx19 UTSW 9 30427721 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCATGGGTTAGTGCACTCTG -3'
(R):5'- ATGTCTCTGCTGAGCACAAGAG -3'

Sequencing Primer
(F):5'- GGAAACCCAGATGCTACCTTTATTC -3'
(R):5'- GAGAAGTAAGCACTGCACAGTCC -3'
Posted On 2020-07-13