Incidental Mutation 'R8548:Ints9'
ID 659754
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8548 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 64950045-65039832 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65032321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 487 (S487P)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
AlphaFold Q8K114
Predicted Effect probably benign
Transcript: ENSMUST00000043914
AA Change: S487P

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: S487P

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a A T 5: 121,520,102 L376Q probably damaging Het
Akirin1 A G 4: 123,738,038 M179T possibly damaging Het
Ap5b1 G T 19: 5,571,095 V848L possibly damaging Het
Apoa2 T A 1: 171,226,229 M91K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cdc20 A C 4: 118,436,338 S160A possibly damaging Het
Cftr G T 6: 18,273,699 V839L possibly damaging Het
Ctf1 A T 7: 127,717,392 H171L probably benign Het
Dmac2 T A 7: 25,624,792 M225K probably damaging Het
Dmbx1 A T 4: 115,920,315 V112E probably damaging Het
Eloa T C 4: 136,005,677 K754R probably damaging Het
Ern2 G A 7: 122,177,839 T286I probably damaging Het
Fam135b T C 15: 71,462,810 D845G probably damaging Het
Fbxl6 T A 15: 76,537,342 M232L possibly damaging Het
Gpr171 A T 3: 59,097,979 I125K probably damaging Het
Hoxa2 G A 6: 52,163,118 T296I probably damaging Het
Hspa8 A G 9: 40,802,471 M87V probably benign Het
Ilkap G T 1: 91,391,160 D31E possibly damaging Het
Macc1 T A 12: 119,450,356 S756T probably benign Het
Map2 A G 1: 66,413,340 D545G probably damaging Het
Mapkbp1 A G 2: 120,024,091 N1390D probably benign Het
Mgat5 G A 1: 127,320,672 V104M possibly damaging Het
Myoz2 T A 3: 123,034,267 M1L possibly damaging Het
Nmt1 A G 11: 103,043,226 K64E possibly damaging Het
Nr6a1 C A 2: 38,729,538 Q448H probably damaging Het
Nr6a1 T G 2: 38,729,539 Q448P probably damaging Het
Odf2 T C 2: 29,893,514 probably null Het
Olfr970 T A 9: 39,820,241 C201S probably benign Het
Osbpl6 A G 2: 76,579,222 N476S possibly damaging Het
Pclo A G 5: 14,682,254 probably null Het
Plxnd1 C T 6: 115,957,597 D1792N probably damaging Het
Prdm11 C T 2: 93,012,758 V119M probably damaging Het
Prss23 A G 7: 89,510,208 F218L probably benign Het
Rflnb A G 11: 76,022,221 Y114H probably damaging Het
Skor2 T A 18: 76,858,886 I101N unknown Het
Sp8 A C 12: 118,849,175 Y255S possibly damaging Het
Srfbp1 G A 18: 52,488,391 V175I probably benign Het
Stxbp5 C T 10: 9,817,306 D359N probably null Het
Thnsl1 A G 2: 21,212,922 I496V possibly damaging Het
Usp32 G A 11: 85,017,827 P1018S possibly damaging Het
Usp7 A T 16: 8,712,075 V142E possibly damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1525:Ints9 UTSW 14 64995011 missense probably benign 0.05
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R3015:Ints9 UTSW 14 64950278 missense probably benign 0.00
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6241:Ints9 UTSW 14 64980210 missense possibly damaging 0.90
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
R7422:Ints9 UTSW 14 65032298 missense possibly damaging 0.93
R7442:Ints9 UTSW 14 64995064 nonsense probably null
R7475:Ints9 UTSW 14 65026465 missense probably null 0.23
R8183:Ints9 UTSW 14 65036453 missense probably damaging 0.98
R8223:Ints9 UTSW 14 65020360 missense possibly damaging 0.94
R8282:Ints9 UTSW 14 65007308 missense probably benign 0.00
R8314:Ints9 UTSW 14 65029030 missense probably damaging 1.00
R8341:Ints9 UTSW 14 65036414 missense probably benign 0.14
R9356:Ints9 UTSW 14 65032321 missense probably benign 0.39
R9434:Ints9 UTSW 14 65008057 missense probably benign 0.00
Z1176:Ints9 UTSW 14 65037454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCATACTGTTTCCTTGCG -3'
(R):5'- GGCAGCATCCTACAGAACTGAAG -3'

Sequencing Primer
(F):5'- GCGCATCCTTTCCTGACAAGG -3'
(R):5'- GTAGACCTGGTCCACAAA -3'
Posted On 2021-01-18