Incidental Mutation 'R8731:Cap2'
ID662769
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene NameCAP, adenylate cyclase-associated protein, 2 (yeast)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R8731 (G1)
Quality Score208.009
Status Validated
Chromosome13
Chromosomal Location46501848-46650281 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46646530 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 404 (M404T)
Ref Sequence ENSEMBL: ENSMUSP00000021802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
Predicted Effect probably benign
Transcript: ENSMUST00000021802
AA Change: M404T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: M404T

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119341
AA Change: M292T

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: M292T

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126687
Predicted Effect probably benign
Transcript: ENSMUST00000225824
AA Change: M349T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 95.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 60,024,946 D294V probably benign Het
Abcc8 T G 7: 46,154,562 Y396S probably damaging Het
Ace T A 11: 105,970,600 F192I possibly damaging Het
Apeh A G 9: 108,087,223 S494P probably benign Het
Bod1 A G 11: 31,669,242 probably null Het
Cc2d2a A T 5: 43,735,446 D1450V probably damaging Het
Ccdc144b A T 3: 36,035,285 N163K probably benign Het
Cdk5rap2 A T 4: 70,245,510 probably benign Het
Clip1 A C 5: 123,614,693 S342A Het
Cox10 A G 11: 63,964,219 F412S probably damaging Het
Cracr2a T G 6: 127,625,927 probably null Het
Dcaf7 T A 11: 106,054,722 M299K possibly damaging Het
Dffb T C 4: 153,974,644 T59A possibly damaging Het
Dgkd A G 1: 87,916,813 M234V possibly damaging Het
Disp1 A T 1: 183,087,508 V1116E possibly damaging Het
Dpysl3 C T 18: 43,438,092 C39Y probably damaging Het
Dync1h1 T A 12: 110,640,584 V2565D possibly damaging Het
Fam227b A T 2: 126,126,978 Y59N possibly damaging Het
Gm21680 A T 5: 25,968,232 V210D probably damaging Het
Gnas T C 2: 174,284,906 V78A probably benign Het
Gpr179 T C 11: 97,343,729 T509A probably damaging Het
Igfn1 A G 1: 135,997,836 M60T probably benign Het
Llgl2 A G 11: 115,851,190 Q686R probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk3 T G 8: 85,359,005 E300A probably benign Het
Myo1b A C 1: 51,760,411 probably benign Het
Myo9b T C 8: 71,353,842 probably null Het
Nalcn T C 14: 123,599,854 I33V probably benign Het
Nsl1 A G 1: 191,082,412 Y270C probably damaging Het
Olfr312 C T 11: 58,831,442 A96V probably benign Het
Otulin A G 15: 27,608,842 M205T probably benign Het
Plch1 A T 3: 63,697,638 V1615E probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn3a A T 2: 65,468,163 Y1397* probably null Het
Scrib A T 15: 76,063,639 H549Q probably benign Het
Slc36a4 A G 9: 15,719,752 I56V possibly damaging Het
Spata7 T A 12: 98,658,282 S148T probably damaging Het
Stk31 T A 6: 49,438,501 L590Q probably benign Het
Tanc1 T C 2: 59,843,252 V1567A probably benign Het
Tspan33 T C 6: 29,717,311 F237S probably damaging Het
Uhrf1 T A 17: 56,322,363 L737Q probably damaging Het
Vmn2r2 A G 3: 64,116,983 F726L probably benign Het
Vmn2r65 A T 7: 84,940,239 L823* probably null Het
Vps11 T C 9: 44,354,459 N508D probably benign Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46639949 splice site probably benign
IGL01927:Cap2 APN 13 46635633 missense probably benign 0.03
IGL02213:Cap2 APN 13 46635611 splice site probably benign
IGL02511:Cap2 APN 13 46531022 start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46525492 missense probably benign 0.00
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0385:Cap2 UTSW 13 46560547 missense probably damaging 1.00
R0387:Cap2 UTSW 13 46560516 missense probably damaging 0.99
R0712:Cap2 UTSW 13 46615361 splice site probably null
R1489:Cap2 UTSW 13 46609635 missense probably damaging 1.00
R1666:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1668:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1676:Cap2 UTSW 13 46637859 missense probably damaging 1.00
R1756:Cap2 UTSW 13 46531013 missense probably benign 0.11
R1822:Cap2 UTSW 13 46615347 missense probably benign 0.03
R1867:Cap2 UTSW 13 46640079 missense probably damaging 1.00
R1972:Cap2 UTSW 13 46637899 missense probably damaging 0.98
R1990:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46560502 critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46639841 missense probably benign 0.20
R4024:Cap2 UTSW 13 46637841 splice site probably benign
R4554:Cap2 UTSW 13 46635774 missense probably damaging 1.00
R4748:Cap2 UTSW 13 46639826 missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46610110 missense probably damaging 0.99
R4876:Cap2 UTSW 13 46531021 start codon destroyed probably null
R4902:Cap2 UTSW 13 46531025 missense probably damaging 0.99
R5320:Cap2 UTSW 13 46648364 makesense probably null
R5666:Cap2 UTSW 13 46531083 splice site probably null
R5670:Cap2 UTSW 13 46531083 splice site probably null
R6086:Cap2 UTSW 13 46635712 missense probably damaging 1.00
R6728:Cap2 UTSW 13 46639859 missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46646625 missense probably damaging 1.00
R7785:Cap2 UTSW 13 46635748 missense probably benign
R7889:Cap2 UTSW 13 46646575 missense probably damaging 0.99
R8065:Cap2 UTSW 13 46637861 missense probably damaging 1.00
R8205:Cap2 UTSW 13 46615263 missense probably damaging 1.00
R8425:Cap2 UTSW 13 46609732 missense probably damaging 0.98
R8738:Cap2 UTSW 13 46531072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGACACTTGCCCTGCAC -3'
(R):5'- CACCTCTCTAAGAATGCTAACATG -3'

Sequencing Primer
(F):5'- TTGCCCTGCACGTAGACACAG -3'
(R):5'- TACACCACAAAGCCTTTTCTGGG -3'
Posted On2021-03-08