Incidental Mutation 'R8861:Nuggc'
ID675680
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Namenuclear GTPase, germinal center associated
SynonymsGm600, SLIP-GC, LOC239151
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R8861 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65598546-65648531 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 65610035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
Predicted Effect probably null
Transcript: ENSMUST00000079469
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150897
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,259,961 K1168* probably null Het
Acly A G 11: 100,484,598 probably null Het
Agap2 T G 10: 127,090,514 V896G unknown Het
Agtpbp1 T C 13: 59,495,473 Y724C probably damaging Het
Angpt4 A G 2: 151,925,453 N135D probably damaging Het
Aox3 T A 1: 58,150,301 I387K probably benign Het
Bysl T C 17: 47,606,959 E103G probably benign Het
Chmp5 T A 4: 40,964,608 V208E probably damaging Het
Chst9 T G 18: 15,452,573 H311P possibly damaging Het
Dcaf11 C A 14: 55,564,498 Y235* probably null Het
Dlx5 A C 6: 6,878,233 S266A probably benign Het
Dnah7b T A 1: 46,241,076 S2722T possibly damaging Het
En2 T A 5: 28,166,735 I70N probably damaging Het
Fam72a T C 1: 131,538,918 Y147H possibly damaging Het
Fermt2 A T 14: 45,460,009 F628L possibly damaging Het
Fkrp T A 7: 16,810,824 D371V probably damaging Het
Fmn1 T C 2: 113,364,804 L283P unknown Het
Gm13271 G A 4: 88,755,129 V88I probably benign Het
Gnmt G A 17: 46,726,692 T120M probably damaging Het
H2-T22 A T 17: 36,042,398 V10D possibly damaging Het
Ick T A 9: 78,164,562 N505K probably benign Het
Igf2bp3 A C 6: 49,105,616 M344R possibly damaging Het
Kdm1b T C 13: 47,064,106 V347A probably benign Het
Klra17 A T 6: 129,874,902 S2R probably damaging Het
Klri1 A G 6: 129,698,201 S199P probably benign Het
Ltk T A 2: 119,759,613 Q44L probably benign Het
Matn4 A T 2: 164,392,905 Y549N Het
Mcoln3 T A 3: 146,139,404 F452I probably damaging Het
Mipol1 T C 12: 57,306,016 V47A probably benign Het
Msh4 A G 3: 153,901,468 L145S probably benign Het
Myh11 A T 16: 14,246,782 I224N Het
Nat8f1 A G 6: 85,910,462 L172P probably damaging Het
Ncoa7 T A 10: 30,691,368 K438I probably benign Het
Nr1h3 T G 2: 91,193,681 probably benign Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1271 T C 2: 90,266,459 probably benign Het
Olfr871 A T 9: 20,213,081 H244L probably damaging Het
Pfn4 T A 12: 4,775,456 Y98N probably benign Het
Ppp6r2 T G 15: 89,259,165 C172G probably damaging Het
Ptprk A G 10: 28,570,190 D979G probably damaging Het
Rbm28 A G 6: 29,152,285 I329T probably damaging Het
Rnf144a T C 12: 26,339,344 T33A probably damaging Het
Rnf145 A G 11: 44,555,157 T273A probably damaging Het
Rnf213 G A 11: 119,442,236 R2758H Het
Slc22a19 A T 19: 7,682,959 M362K possibly damaging Het
Slc29a4 G C 5: 142,718,825 R374P probably damaging Het
Slc43a1 A G 2: 84,861,404 T528A possibly damaging Het
Sp3 A T 2: 72,971,286 Y172N probably damaging Het
Srpr T A 9: 35,215,749 M573K probably benign Het
Steap4 A G 5: 7,975,672 I78V probably benign Het
Sulf2 A G 2: 166,132,686 L26P possibly damaging Het
Taok2 T C 7: 126,871,443 K738E probably damaging Het
Tcea3 G A 4: 136,254,499 R56H probably damaging Het
Tcf20 A G 15: 82,852,525 V1575A probably damaging Het
Togaram1 T G 12: 64,980,632 S798R possibly damaging Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R8250:Nuggc UTSW 14 65641869 missense probably benign 0.10
R8329:Nuggc UTSW 14 65641282 missense probably benign 0.01
R8334:Nuggc UTSW 14 65645029 missense probably benign 0.04
R8463:Nuggc UTSW 14 65613562 missense probably damaging 1.00
R8503:Nuggc UTSW 14 65641348 critical splice donor site probably null
R8737:Nuggc UTSW 14 65645086 missense probably benign 0.00
R8914:Nuggc UTSW 14 65641905 missense probably benign
RF019:Nuggc UTSW 14 65648264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGAATCACTGGAGCTGG -3'
(R):5'- GCATATGTGTACATGTTTGCCC -3'

Sequencing Primer
(F):5'- CTGGCAAGAGCTCTCTGATCAATG -3'
(R):5'- CTGGAGGTCCAAACTTAAGCCTATG -3'
Posted On2021-07-15