Incidental Mutation 'R6922:Nuggc'
ID 539697
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Name nuclear GTPase, germinal center associated
Synonyms Gm600, SLIP-GC, LOC239151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 65598546-65648531 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65617643 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 325 (S325P)
Ref Sequence ENSEMBL: ENSMUSP00000118402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
AlphaFold D3YWJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000079469
AA Change: S341P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: S341P

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150897
AA Change: S325P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: S325P

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,689 probably null Het
Ago2 T C 15: 73,113,752 I665V probably benign Het
Arhgap32 A T 9: 32,152,687 M74L possibly damaging Het
Asb4 T C 6: 5,398,304 C90R possibly damaging Het
B3galt4 T A 17: 33,950,847 D139V probably damaging Het
Camta2 A C 11: 70,674,138 I852S probably benign Het
Cox4i2 G T 2: 152,757,095 E57D probably benign Het
Dip2b T C 15: 100,193,843 I1055T probably benign Het
Eif4g3 C T 4: 138,097,335 P284S probably damaging Het
Ephb1 C A 9: 101,929,264 probably null Het
Fbxw7 A T 3: 84,972,416 probably null Het
Frem1 C A 4: 82,922,269 D1789Y probably damaging Het
Gm16368 T A 12: 88,083,832 W46R probably benign Het
Gm29106 A T 1: 118,199,794 R405S probably damaging Het
Gm609 A T 16: 45,443,931 M88K probably benign Het
Greb1l G A 18: 10,547,482 V1567M possibly damaging Het
Heatr1 C A 13: 12,435,075 D1983E probably benign Het
Lhfpl2 G T 13: 94,174,521 A100S probably damaging Het
Lrp5 A T 19: 3,605,301 V1073D probably damaging Het
Naip6 G A 13: 100,302,198 L364F possibly damaging Het
Nek9 A G 12: 85,303,537 L921P probably damaging Het
Nim1k C T 13: 119,727,727 E49K probably damaging Het
Nsun5 A C 5: 135,370,192 N32T probably damaging Het
Olfr1135 T A 2: 87,671,453 K305* probably null Het
Olfr716 A G 7: 107,148,083 I256V probably damaging Het
Pcdhga7 A G 18: 37,715,657 D239G probably damaging Het
Pld2 A G 11: 70,553,447 D523G probably benign Het
Prokr1 C A 6: 87,588,473 W130L probably damaging Het
Prpf8 A G 11: 75,490,736 N266S probably damaging Het
Rdh10 T C 1: 16,106,031 V5A probably benign Het
Rp1l1 T C 14: 64,030,385 L1140P possibly damaging Het
Sacs A G 14: 61,211,425 D3640G probably damaging Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Svs1 T G 6: 48,987,574 F172C probably damaging Het
Tlk2 T C 11: 105,256,953 probably null Het
Tmprss4 A G 9: 45,185,922 V15A probably benign Het
Togaram2 T C 17: 71,707,134 L559P probably damaging Het
Topbp1 T A 9: 103,335,846 L990H probably damaging Het
Ttll7 A G 3: 146,909,614 T278A possibly damaging Het
Ttn G A 2: 76,774,436 L18385F probably damaging Het
Upf3a G T 8: 13,791,911 A149S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp316 A T 5: 143,253,525 F913Y probably damaging Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R8250:Nuggc UTSW 14 65641869 missense probably benign 0.10
R8329:Nuggc UTSW 14 65641282 missense probably benign 0.01
R8334:Nuggc UTSW 14 65645029 missense probably benign 0.04
R8463:Nuggc UTSW 14 65613562 missense probably damaging 1.00
R8503:Nuggc UTSW 14 65641348 critical splice donor site probably null
R8737:Nuggc UTSW 14 65645086 missense probably benign 0.00
R8861:Nuggc UTSW 14 65610035 critical splice donor site probably null
R8914:Nuggc UTSW 14 65641905 missense probably benign
R9573:Nuggc UTSW 14 65611154 missense probably benign 0.37
R9666:Nuggc UTSW 14 65619596 missense possibly damaging 0.86
R9792:Nuggc UTSW 14 65609896 missense probably damaging 1.00
R9793:Nuggc UTSW 14 65609896 missense probably damaging 1.00
R9795:Nuggc UTSW 14 65609896 missense probably damaging 1.00
RF019:Nuggc UTSW 14 65648264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGAGCCACTTTGTTGG -3'
(R):5'- TTTCATAGCCAGAACCCAGG -3'

Sequencing Primer
(F):5'- CAGAGTGGAGTGGGAGCTCTG -3'
(R):5'- GAAAGAAAGTCCCCAGGCTG -3'
Posted On 2018-11-06