Incidental Mutation 'R8918:Peg10'
ID 679050
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms HB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8918 (G1)
Quality Score 137.467
Status Not validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm38)
Type of Mutation small deletion (18 aa in frame mutation)
DNA Base Change (assembly) CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG at 4756398 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,719,441 K884R possibly damaging Het
Acacb T C 5: 114,195,254 F480L probably damaging Het
Actr6 A T 10: 89,717,195 I267N probably damaging Het
Ank2 A G 3: 126,943,731 S2835P unknown Het
Arfgef3 C T 10: 18,635,705 R753Q probably benign Het
Arid3a A G 10: 79,948,931 T285A probably benign Het
Atad5 T C 11: 80,095,647 V520A probably benign Het
Atoh1 T G 6: 64,730,257 L312R probably damaging Het
Cpt1a T C 19: 3,358,258 V179A Het
Crocc2 C A 1: 93,201,422 N816K possibly damaging Het
Csf2ra A T 19: 61,226,283 V201D probably damaging Het
Dok1 C T 6: 83,031,343 V453I probably benign Het
Elp4 A G 2: 105,832,255 S175P probably benign Het
Erh G T 12: 80,637,508 A65E probably benign Het
Etl4 G A 2: 20,743,922 S357N probably benign Het
Etl4 A G 2: 20,806,435 T1478A probably benign Het
Gabra1 A G 11: 42,135,493 F324S probably damaging Het
Gm11437 T C 11: 84,152,704 T254A probably benign Het
Gm14409 A C 2: 177,266,758 S29R probably benign Het
Gria2 T C 3: 80,692,399 E726G probably damaging Het
Gstm2 A T 3: 107,985,066 C115S possibly damaging Het
Ighv1-12 T C 12: 114,615,933 T90A probably damaging Het
Inf2 A G 12: 112,606,269 I690V unknown Het
Kdm3b A G 18: 34,837,597 N1739S probably damaging Het
Lrp1b A T 2: 40,725,881 N3614K Het
Mapk8ip3 A G 17: 24,912,753 L404P probably damaging Het
Mcl1 T C 3: 95,659,881 F251S probably damaging Het
Mdn1 T A 4: 32,744,579 L4038* probably null Het
Mmp8 T C 9: 7,561,484 V163A probably benign Het
Myo18b C T 5: 112,875,007 probably benign Het
Ndst1 C T 18: 60,692,011 R745H probably benign Het
Olfr462 A G 11: 87,889,458 V146A probably benign Het
Olfr896-ps1 T C 9: 38,292,089 F48S probably benign Het
Pard3 C T 8: 127,371,530 R351C probably benign Het
Pcdhgb4 A G 18: 37,722,595 D681G probably damaging Het
Pde10a G A 17: 8,941,231 A163T possibly damaging Het
Pelp1 A G 11: 70,405,679 L123S probably damaging Het
Plekhh2 A G 17: 84,599,193 D1152G possibly damaging Het
Rag1 T C 2: 101,641,753 T1015A probably benign Het
Rock2 C T 12: 16,940,421 Q115* probably null Het
Rorb T A 19: 18,937,992 H434L probably damaging Het
Safb2 A T 17: 56,575,975 C219* probably null Het
Sema3a A G 5: 13,523,132 H209R probably damaging Het
Serpinb9g T G 13: 33,495,148 S334A probably benign Het
Slc5a9 T A 4: 111,883,950 M500L probably benign Het
Snap91 A G 9: 86,769,558 S810P unknown Het
Spink5 G T 18: 43,967,020 A35S probably damaging Het
Stxbp5l G A 16: 37,134,530 T887I Het
Tacc2 T C 7: 130,626,093 F1503L probably benign Het
Tectb A G 19: 55,191,568 E272G probably damaging Het
Trdn A T 10: 33,139,121 I24F probably benign Het
Tshr G A 12: 91,537,437 S383N probably benign Het
Tspan1 C A 4: 116,163,773 C149F probably damaging Het
Ttn A T 2: 76,740,518 L26677Q probably damaging Het
Ush2a T A 1: 188,537,820 F1755I possibly damaging Het
Vps13d T A 4: 145,046,303 I4047F Het
Zfp369 T A 13: 65,295,715 L336* probably null Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp984 T C 4: 147,756,166 H76R possibly damaging Het
Zscan10 G A 17: 23,607,142 G138S probably benign Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7120:Peg10 UTSW 6 4756398 small deletion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7803:Peg10 UTSW 6 4756431 small deletion probably benign
R7816:Peg10 UTSW 6 4756453 small insertion probably benign
R7820:Peg10 UTSW 6 4756398 small deletion probably benign
R7827:Peg10 UTSW 6 4756452 small insertion probably benign
R7861:Peg10 UTSW 6 4756431 small deletion probably benign
R7881:Peg10 UTSW 6 4756454 small insertion probably benign
R7904:Peg10 UTSW 6 4756452 small insertion probably benign
R7915:Peg10 UTSW 6 4756451 small insertion probably benign
R7916:Peg10 UTSW 6 4756451 small insertion probably benign
R7963:Peg10 UTSW 6 4756452 small insertion probably benign
R8016:Peg10 UTSW 6 4756451 small insertion probably benign
R8037:Peg10 UTSW 6 4756398 small deletion probably benign
R8062:Peg10 UTSW 6 4756398 small deletion probably benign
R8081:Peg10 UTSW 6 4756452 small insertion probably benign
R8113:Peg10 UTSW 6 4756451 small insertion probably benign
R8115:Peg10 UTSW 6 4756707 missense unknown
R8140:Peg10 UTSW 6 4756113 missense unknown
R8178:Peg10 UTSW 6 4756452 small insertion probably benign
R8233:Peg10 UTSW 6 4756453 small insertion probably benign
R8239:Peg10 UTSW 6 4756452 small insertion probably benign
R8281:Peg10 UTSW 6 4756431 small deletion probably benign
R8310:Peg10 UTSW 6 4756454 small insertion probably benign
R8312:Peg10 UTSW 6 4756452 small insertion probably benign
R8330:Peg10 UTSW 6 4756452 small insertion probably benign
R8338:Peg10 UTSW 6 4756398 small deletion probably benign
R8354:Peg10 UTSW 6 4756452 small insertion probably benign
R8387:Peg10 UTSW 6 4756452 small insertion probably benign
R8390:Peg10 UTSW 6 4756451 small insertion probably benign
R8408:Peg10 UTSW 6 4756453 small insertion probably benign
R8415:Peg10 UTSW 6 4756451 small insertion probably benign
R8439:Peg10 UTSW 6 4755462 missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4756398 small deletion probably benign
R8463:Peg10 UTSW 6 4756453 small insertion probably benign
R8477:Peg10 UTSW 6 4756453 small insertion probably benign
R8507:Peg10 UTSW 6 4756453 small insertion probably benign
R8552:Peg10 UTSW 6 4756452 small insertion probably benign
R8678:Peg10 UTSW 6 4756431 small deletion probably benign
R8699:Peg10 UTSW 6 4756451 small insertion probably benign
R8700:Peg10 UTSW 6 4756451 small insertion probably benign
R8705:Peg10 UTSW 6 4756398 small deletion probably benign
R8765:Peg10 UTSW 6 4754492 missense unknown
R8824:Peg10 UTSW 6 4756451 small insertion probably benign
R8859:Peg10 UTSW 6 4756451 small insertion probably benign
R8870:Peg10 UTSW 6 4754825 missense probably damaging 0.99
R8909:Peg10 UTSW 6 4756451 small insertion probably benign
R8924:Peg10 UTSW 6 4756398 small deletion probably benign
R8925:Peg10 UTSW 6 4756452 small insertion probably benign
R8930:Peg10 UTSW 6 4756449 small insertion probably benign
R8950:Peg10 UTSW 6 4756452 small insertion probably benign
R8960:Peg10 UTSW 6 4756449 small insertion probably benign
R8975:Peg10 UTSW 6 4756452 small insertion probably benign
R8988:Peg10 UTSW 6 4756398 small deletion probably benign
R9046:Peg10 UTSW 6 4756452 small insertion probably benign
R9068:Peg10 UTSW 6 4756451 small insertion probably benign
R9074:Peg10 UTSW 6 4756451 small insertion probably benign
R9088:Peg10 UTSW 6 4756453 small insertion probably benign
R9094:Peg10 UTSW 6 4756449 small insertion probably benign
R9114:Peg10 UTSW 6 4756452 small insertion probably benign
R9116:Peg10 UTSW 6 4756452 small insertion probably benign
R9135:Peg10 UTSW 6 4756453 small insertion probably benign
R9137:Peg10 UTSW 6 4756398 small deletion probably benign
R9139:Peg10 UTSW 6 4756449 small insertion probably benign
R9139:Peg10 UTSW 6 4757128 missense unknown
R9171:Peg10 UTSW 6 4756452 small insertion probably benign
R9173:Peg10 UTSW 6 4756451 small insertion probably benign
R9213:Peg10 UTSW 6 4756451 small insertion probably benign
R9216:Peg10 UTSW 6 4756452 small insertion probably benign
R9229:Peg10 UTSW 6 4756398 small deletion probably benign
R9233:Peg10 UTSW 6 4756398 small deletion probably benign
R9283:Peg10 UTSW 6 4756452 small insertion probably benign
R9328:Peg10 UTSW 6 4756398 small deletion probably benign
R9367:Peg10 UTSW 6 4756398 small deletion probably benign
R9369:Peg10 UTSW 6 4756452 small insertion probably benign
R9405:Peg10 UTSW 6 4756398 small deletion probably benign
R9410:Peg10 UTSW 6 4756452 small insertion probably benign
R9412:Peg10 UTSW 6 4756453 small insertion probably benign
R9421:Peg10 UTSW 6 4756398 small deletion probably benign
R9437:Peg10 UTSW 6 4756451 small insertion probably benign
R9440:Peg10 UTSW 6 4756451 small insertion probably benign
R9460:Peg10 UTSW 6 4756452 small insertion probably benign
R9492:Peg10 UTSW 6 4756398 small deletion probably benign
R9495:Peg10 UTSW 6 4756451 small insertion probably benign
R9500:Peg10 UTSW 6 4756871 missense unknown
R9511:Peg10 UTSW 6 4756451 small insertion probably benign
R9515:Peg10 UTSW 6 4756452 small insertion probably benign
R9576:Peg10 UTSW 6 4756398 small deletion probably benign
R9610:Peg10 UTSW 6 4756452 small insertion probably benign
R9611:Peg10 UTSW 6 4756452 small insertion probably benign
R9611:Peg10 UTSW 6 4756453 small insertion probably benign
R9614:Peg10 UTSW 6 4756451 small insertion probably benign
R9619:Peg10 UTSW 6 4755316 missense probably benign 0.02
R9646:Peg10 UTSW 6 4756452 small insertion probably benign
R9655:Peg10 UTSW 6 4756398 small deletion probably benign
R9673:Peg10 UTSW 6 4756452 small insertion probably benign
R9675:Peg10 UTSW 6 4756398 small deletion probably benign
R9696:Peg10 UTSW 6 4756431 small deletion probably benign
R9749:Peg10 UTSW 6 4756398 small deletion probably benign
R9756:Peg10 UTSW 6 4756452 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4756451 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTACAGTGCCACAACCG -3'
(R):5'- CCAGCCATGTGGTAGAAGAATG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- TAGAAGAATGGTGGCTGCTG -3'
Posted On 2021-08-02