Incidental Mutation 'R8899:Cd209e'
ID 679839
Institutional Source Beutler Lab
Gene Symbol Cd209e
Ensembl Gene ENSMUSG00000040197
Gene Name CD209e antigen
Synonyms mSIGNR4, SIGNR4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R8899 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3847965-3854309 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 3851212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 147 (W147*)
Ref Sequence ENSEMBL: ENSMUSP00000033888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033888]
AlphaFold Q91ZW7
Predicted Effect probably null
Transcript: ENSMUST00000033888
AA Change: W147*
SMART Domains Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: W147*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 77 198 4.01e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,988,280 I2805T probably damaging Het
Agxt2 A T 15: 10,378,814 N167I probably damaging Het
Arel1 A G 12: 84,934,243 I330T probably benign Het
Ate1 T C 7: 130,394,659 K484E possibly damaging Het
Atl2 T C 17: 79,876,040 D42G probably benign Het
Cdc40 G A 10: 40,841,813 Q365* probably null Het
Cenpe A G 3: 135,239,883 T1053A probably benign Het
Colgalt1 T C 8: 71,623,662 S586P probably damaging Het
Crem A G 18: 3,295,370 I91T probably damaging Het
Csrnp3 G A 2: 66,022,643 V460I possibly damaging Het
Cul1 T A 6: 47,497,312 I136N possibly damaging Het
Ddx19b A T 8: 111,011,297 I273N probably damaging Het
Fap A G 2: 62,518,473 I505T probably damaging Het
Fbxo44 A T 4: 148,153,621 Y216* probably null Het
Fbxw10 T A 11: 62,857,741 M398K probably damaging Het
Fut10 T C 8: 31,236,486 V423A possibly damaging Het
Fyco1 A C 9: 123,826,581 D1037E probably benign Het
Gabrg2 G A 11: 41,976,550 R81* probably null Het
Gcn1l1 T C 5: 115,579,161 V204A probably benign Het
Gm5615 A T 9: 36,534,958 C53S probably damaging Het
Gnl1 T C 17: 35,988,716 L593P probably damaging Het
Grm4 T C 17: 27,434,780 Q732R probably damaging Het
Icam5 T C 9: 21,037,119 V741A possibly damaging Het
Iqub C T 6: 24,505,769 E47K probably benign Het
Kcnk3 A G 5: 30,622,236 K210R probably benign Het
Kdm2b T A 5: 122,987,788 R12* probably null Het
Kif1bp T C 10: 62,563,503 probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lgi1 C T 19: 38,306,090 H413Y probably damaging Het
Lhx8 A G 3: 154,328,016 Y51H probably damaging Het
Lim2 T C 7: 43,433,631 I80T probably benign Het
Macf1 A G 4: 123,475,059 F405L probably benign Het
Mefv G A 16: 3,710,900 T559I probably damaging Het
Nin A G 12: 70,030,936 W1739R probably damaging Het
Olfr1101 A G 2: 86,988,366 I270T probably benign Het
Olfr239 A T 17: 33,199,744 K232M probably damaging Het
Olfr736 T C 14: 50,392,812 F19L probably damaging Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Otop3 T C 11: 115,341,060 probably null Het
Pip5kl1 A G 2: 32,579,070 I247V probably benign Het
Polr2d T A 18: 31,789,173 M1K probably null Het
Prss53 T C 7: 127,889,021 T141A possibly damaging Het
Rdh12 A G 12: 79,222,028 N293S probably benign Het
Rnf146 G A 10: 29,347,758 T44I probably benign Het
Rsbn1l A T 5: 20,896,867 C588S probably damaging Het
Sept8 G A 11: 53,536,035 V208I probably damaging Het
Sgo2a T G 1: 58,019,663 S1134A possibly damaging Het
Sh3bp4 C T 1: 89,145,575 T715I probably benign Het
Snrnp200 A G 2: 127,236,597 T1758A probably damaging Het
Snx6 A T 12: 54,765,638 D70E probably benign Het
Spag9 T C 11: 94,092,869 S341P probably damaging Het
Sparcl1 T C 5: 104,092,724 D278G probably benign Het
Srbd1 T A 17: 85,985,457 S895C Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Tas2r136 T C 6: 132,777,360 D268G probably benign Het
Tas2r143 T A 6: 42,400,954 Y239* probably null Het
Tbc1d17 C T 7: 44,842,904 G419D probably damaging Het
Tff2 C T 17: 31,143,139 W68* probably null Het
Thegl T A 5: 77,037,353 probably null Het
Thop1 T C 10: 81,080,606 C483R probably damaging Het
Tmem245 A C 4: 56,903,916 probably null Het
Tmem67 A G 4: 12,055,038 F655S probably damaging Het
Trim36 T G 18: 46,169,197 S583R possibly damaging Het
Ucp1 T C 8: 83,290,587 V2A probably benign Het
Ugt1a6a T A 1: 88,139,081 M203K probably damaging Het
Usp1 A G 4: 98,931,110 K270E probably damaging Het
Vps13c T C 9: 67,934,501 F1935S probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp799 G T 17: 32,820,374 P306Q probably damaging Het
Zfp831 A T 2: 174,644,185 R218W probably damaging Het
Other mutations in Cd209e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cd209e APN 8 3852800 missense probably benign 0.05
IGL00920:Cd209e APN 8 3849187 missense probably damaging 1.00
IGL01132:Cd209e APN 8 3851274 missense probably benign 0.18
IGL02499:Cd209e APN 8 3854238 missense probably benign
R0124:Cd209e UTSW 8 3851274 missense probably benign 0.08
R0268:Cd209e UTSW 8 3849125 missense probably benign 0.34
R0540:Cd209e UTSW 8 3851265 missense probably benign 0.04
R0744:Cd209e UTSW 8 3853205 missense probably benign 0.00
R0836:Cd209e UTSW 8 3853205 missense probably benign 0.00
R1241:Cd209e UTSW 8 3849124 missense probably damaging 0.99
R1367:Cd209e UTSW 8 3849084 makesense probably null
R2040:Cd209e UTSW 8 3849158 missense probably damaging 1.00
R2136:Cd209e UTSW 8 3853248 missense probably benign 0.00
R4787:Cd209e UTSW 8 3851181 missense probably null 0.69
R6283:Cd209e UTSW 8 3849212 nonsense probably null
R6338:Cd209e UTSW 8 3849154 missense probably damaging 1.00
R6894:Cd209e UTSW 8 3853569 missense possibly damaging 0.48
Z1176:Cd209e UTSW 8 3849196 missense probably benign 0.30
Z1177:Cd209e UTSW 8 3851181 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- GGTAGAACCTAAGCAGCTTACAC -3'
(R):5'- TCCCTGAGCATTGATAGGCAG -3'

Sequencing Primer
(F):5'- GCTTACACCAGACCCATCTTC -3'
(R):5'- ACTAGTAGGGTGCCCATGATC -3'
Posted On 2021-08-31