Incidental Mutation 'R8899:Ucp1'
ID 679842
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Name uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms Slc25a7
MMRRC Submission 068756-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8899 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 84016981-84025081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84017216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2 (V2A)
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
AlphaFold P12242
Predicted Effect probably benign
Transcript: ENSMUST00000034146
AA Change: V2A

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: V2A

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,378,900 (GRCm39) N167I probably damaging Het
Arel1 A G 12: 84,981,017 (GRCm39) I330T probably benign Het
Ate1 T C 7: 129,996,389 (GRCm39) K484E possibly damaging Het
Atl2 T C 17: 80,183,469 (GRCm39) D42G probably benign Het
Bltp1 T C 3: 37,042,429 (GRCm39) I2805T probably damaging Het
Cd209e C T 8: 3,901,212 (GRCm39) W147* probably null Het
Cdc40 G A 10: 40,717,809 (GRCm39) Q365* probably null Het
Cenpe A G 3: 134,945,644 (GRCm39) T1053A probably benign Het
Colgalt1 T C 8: 72,076,306 (GRCm39) S586P probably damaging Het
Crem A G 18: 3,295,370 (GRCm39) I91T probably damaging Het
Csrnp3 G A 2: 65,852,987 (GRCm39) V460I possibly damaging Het
Cul1 T A 6: 47,474,246 (GRCm39) I136N possibly damaging Het
Ddx19b A T 8: 111,737,929 (GRCm39) I273N probably damaging Het
Fap A G 2: 62,348,817 (GRCm39) I505T probably damaging Het
Fbxo44 A T 4: 148,238,078 (GRCm39) Y216* probably null Het
Fbxw10 T A 11: 62,748,567 (GRCm39) M398K probably damaging Het
Fut10 T C 8: 31,726,514 (GRCm39) V423A possibly damaging Het
Fyco1 A C 9: 123,655,646 (GRCm39) D1037E probably benign Het
Gabrg2 G A 11: 41,867,377 (GRCm39) R81* probably null Het
Gcn1 T C 5: 115,717,220 (GRCm39) V204A probably benign Het
Gnl1 T C 17: 36,299,608 (GRCm39) L593P probably damaging Het
Grm4 T C 17: 27,653,754 (GRCm39) Q732R probably damaging Het
Icam5 T C 9: 20,948,415 (GRCm39) V741A possibly damaging Het
Iqub C T 6: 24,505,768 (GRCm39) E47K probably benign Het
Kcnk3 A G 5: 30,779,580 (GRCm39) K210R probably benign Het
Kdm2b T A 5: 123,125,851 (GRCm39) R12* probably null Het
Kifbp T C 10: 62,399,282 (GRCm39) probably benign Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lgi1 C T 19: 38,294,538 (GRCm39) H413Y probably damaging Het
Lhx8 A G 3: 154,033,653 (GRCm39) Y51H probably damaging Het
Lim2 T C 7: 43,083,055 (GRCm39) I80T probably benign Het
Macf1 A G 4: 123,368,852 (GRCm39) F405L probably benign Het
Mefv G A 16: 3,528,764 (GRCm39) T559I probably damaging Het
Nin A G 12: 70,077,710 (GRCm39) W1739R probably damaging Het
Or10h1 A T 17: 33,418,718 (GRCm39) K232M probably damaging Het
Or11j4 T C 14: 50,630,269 (GRCm39) F19L probably damaging Het
Or5t16 A G 2: 86,818,710 (GRCm39) I270T probably benign Het
Or8b3b C T 9: 38,584,147 (GRCm39) V198I probably damaging Het
Otop3 T C 11: 115,231,886 (GRCm39) probably null Het
Pate9 A T 9: 36,446,254 (GRCm39) C53S probably damaging Het
Pip5kl1 A G 2: 32,469,082 (GRCm39) I247V probably benign Het
Polr2d T A 18: 31,922,226 (GRCm39) M1K probably null Het
Prss53 T C 7: 127,488,193 (GRCm39) T141A possibly damaging Het
Rdh12 A G 12: 79,268,802 (GRCm39) N293S probably benign Het
Rnf146 G A 10: 29,223,754 (GRCm39) T44I probably benign Het
Rsbn1l A T 5: 21,101,865 (GRCm39) C588S probably damaging Het
Septin8 G A 11: 53,426,862 (GRCm39) V208I probably damaging Het
Sgo2a T G 1: 58,058,822 (GRCm39) S1134A possibly damaging Het
Sh3bp4 C T 1: 89,073,297 (GRCm39) T715I probably benign Het
Snrnp200 A G 2: 127,078,517 (GRCm39) T1758A probably damaging Het
Snx6 A T 12: 54,812,423 (GRCm39) D70E probably benign Het
Spag9 T C 11: 93,983,695 (GRCm39) S341P probably damaging Het
Sparcl1 T C 5: 104,240,590 (GRCm39) D278G probably benign Het
Spmap2l T A 5: 77,185,200 (GRCm39) probably null Het
Srbd1 T A 17: 86,292,885 (GRCm39) S895C Het
Stxbp5l ATTTT ATTTTT 16: 37,036,414 (GRCm39) probably null Het
Tas2r136 T C 6: 132,754,323 (GRCm39) D268G probably benign Het
Tas2r143 T A 6: 42,377,888 (GRCm39) Y239* probably null Het
Tbc1d17 C T 7: 44,492,328 (GRCm39) G419D probably damaging Het
Tff2 C T 17: 31,362,113 (GRCm39) W68* probably null Het
Thop1 T C 10: 80,916,440 (GRCm39) C483R probably damaging Het
Tmem245 A C 4: 56,903,916 (GRCm39) probably null Het
Tmem67 A G 4: 12,055,038 (GRCm39) F655S probably damaging Het
Trim36 T G 18: 46,302,264 (GRCm39) S583R possibly damaging Het
Ugt1a6a T A 1: 88,066,803 (GRCm39) M203K probably damaging Het
Usp1 A G 4: 98,819,347 (GRCm39) K270E probably damaging Het
Vps13c T C 9: 67,841,783 (GRCm39) F1935S probably damaging Het
Zfp521 C A 18: 13,979,137 (GRCm39) L425F probably damaging Het
Zfp799 G T 17: 33,039,348 (GRCm39) P306Q probably damaging Het
Zfp831 A T 2: 174,485,978 (GRCm39) R218W probably damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 84,020,577 (GRCm39) missense probably damaging 1.00
R0050:Ucp1 UTSW 8 84,020,857 (GRCm39) missense probably damaging 1.00
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0505:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 84,018,232 (GRCm39) splice site probably benign
R0681:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 84,024,476 (GRCm39) splice site probably benign
R1606:Ucp1 UTSW 8 84,021,933 (GRCm39) missense probably damaging 1.00
R1722:Ucp1 UTSW 8 84,017,317 (GRCm39) missense probably benign 0.25
R1809:Ucp1 UTSW 8 84,024,496 (GRCm39) missense probably damaging 0.99
R1823:Ucp1 UTSW 8 84,020,661 (GRCm39) missense probably damaging 1.00
R3809:Ucp1 UTSW 8 84,017,270 (GRCm39) missense probably damaging 0.99
R4085:Ucp1 UTSW 8 84,020,580 (GRCm39) missense probably benign 0.43
R4673:Ucp1 UTSW 8 84,021,876 (GRCm39) missense probably damaging 1.00
R4998:Ucp1 UTSW 8 84,024,484 (GRCm39) critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 84,020,832 (GRCm39) missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 84,017,320 (GRCm39) missense probably benign 0.12
R5790:Ucp1 UTSW 8 84,024,520 (GRCm39) missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 84,020,567 (GRCm39) missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 84,020,718 (GRCm39) critical splice donor site probably null
R6732:Ucp1 UTSW 8 84,018,106 (GRCm39) missense probably benign 0.08
R7282:Ucp1 UTSW 8 84,020,531 (GRCm39) missense probably benign 0.03
R7343:Ucp1 UTSW 8 84,021,881 (GRCm39) missense probably damaging 0.99
R7878:Ucp1 UTSW 8 84,024,521 (GRCm39) missense probably benign 0.19
R8008:Ucp1 UTSW 8 84,020,640 (GRCm39) missense probably benign 0.32
R8365:Ucp1 UTSW 8 84,020,628 (GRCm39) missense probably damaging 0.97
R9186:Ucp1 UTSW 8 84,017,272 (GRCm39) nonsense probably null
R9499:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9551:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9552:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGGGCTTAACGGGTC -3'
(R):5'- AGTGGTTAAACCGTAGCACAC -3'

Sequencing Primer
(F):5'- AAGGGACGCTCACCTTTG -3'
(R):5'- GTGGTTAAACCGTAGCACACATCAC -3'
Posted On 2021-08-31