Incidental Mutation 'R8899:Nin'
ID 679858
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8899 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 70011435-70113717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70030936 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1739 (W1739R)
Ref Sequence ENSEMBL: ENSMUSP00000152350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: W1739R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: W1739R

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: W1739R

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: W1739R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: W1739R

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: W1739R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: W1739R

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220689
AA Change: W1032R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000221579
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: W1739R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,988,280 I2805T probably damaging Het
Agxt2 A T 15: 10,378,814 N167I probably damaging Het
Arel1 A G 12: 84,934,243 I330T probably benign Het
Ate1 T C 7: 130,394,659 K484E possibly damaging Het
Atl2 T C 17: 79,876,040 D42G probably benign Het
Cd209e C T 8: 3,851,212 W147* probably null Het
Cdc40 G A 10: 40,841,813 Q365* probably null Het
Cenpe A G 3: 135,239,883 T1053A probably benign Het
Colgalt1 T C 8: 71,623,662 S586P probably damaging Het
Crem A G 18: 3,295,370 I91T probably damaging Het
Csrnp3 G A 2: 66,022,643 V460I possibly damaging Het
Cul1 T A 6: 47,497,312 I136N possibly damaging Het
Ddx19b A T 8: 111,011,297 I273N probably damaging Het
Fap A G 2: 62,518,473 I505T probably damaging Het
Fbxo44 A T 4: 148,153,621 Y216* probably null Het
Fbxw10 T A 11: 62,857,741 M398K probably damaging Het
Fut10 T C 8: 31,236,486 V423A possibly damaging Het
Fyco1 A C 9: 123,826,581 D1037E probably benign Het
Gabrg2 G A 11: 41,976,550 R81* probably null Het
Gcn1l1 T C 5: 115,579,161 V204A probably benign Het
Gm5615 A T 9: 36,534,958 C53S probably damaging Het
Gnl1 T C 17: 35,988,716 L593P probably damaging Het
Grm4 T C 17: 27,434,780 Q732R probably damaging Het
Icam5 T C 9: 21,037,119 V741A possibly damaging Het
Iqub C T 6: 24,505,769 E47K probably benign Het
Kcnk3 A G 5: 30,622,236 K210R probably benign Het
Kdm2b T A 5: 122,987,788 R12* probably null Het
Kif1bp T C 10: 62,563,503 probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lgi1 C T 19: 38,306,090 H413Y probably damaging Het
Lhx8 A G 3: 154,328,016 Y51H probably damaging Het
Lim2 T C 7: 43,433,631 I80T probably benign Het
Macf1 A G 4: 123,475,059 F405L probably benign Het
Mefv G A 16: 3,710,900 T559I probably damaging Het
Olfr1101 A G 2: 86,988,366 I270T probably benign Het
Olfr239 A T 17: 33,199,744 K232M probably damaging Het
Olfr736 T C 14: 50,392,812 F19L probably damaging Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Otop3 T C 11: 115,341,060 probably null Het
Pip5kl1 A G 2: 32,579,070 I247V probably benign Het
Polr2d T A 18: 31,789,173 M1K probably null Het
Prss53 T C 7: 127,889,021 T141A possibly damaging Het
Rdh12 A G 12: 79,222,028 N293S probably benign Het
Rnf146 G A 10: 29,347,758 T44I probably benign Het
Rsbn1l A T 5: 20,896,867 C588S probably damaging Het
Sept8 G A 11: 53,536,035 V208I probably damaging Het
Sgo2a T G 1: 58,019,663 S1134A possibly damaging Het
Sh3bp4 C T 1: 89,145,575 T715I probably benign Het
Snrnp200 A G 2: 127,236,597 T1758A probably damaging Het
Snx6 A T 12: 54,765,638 D70E probably benign Het
Spag9 T C 11: 94,092,869 S341P probably damaging Het
Sparcl1 T C 5: 104,092,724 D278G probably benign Het
Srbd1 T A 17: 85,985,457 S895C Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Tas2r136 T C 6: 132,777,360 D268G probably benign Het
Tas2r143 T A 6: 42,400,954 Y239* probably null Het
Tbc1d17 C T 7: 44,842,904 G419D probably damaging Het
Tff2 C T 17: 31,143,139 W68* probably null Het
Thegl T A 5: 77,037,353 probably null Het
Thop1 T C 10: 81,080,606 C483R probably damaging Het
Tmem245 A C 4: 56,903,916 probably null Het
Tmem67 A G 4: 12,055,038 F655S probably damaging Het
Trim36 T G 18: 46,169,197 S583R possibly damaging Het
Ucp1 T C 8: 83,290,587 V2A probably benign Het
Ugt1a6a T A 1: 88,139,081 M203K probably damaging Het
Usp1 A G 4: 98,931,110 K270E probably damaging Het
Vps13c T C 9: 67,934,501 F1935S probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp799 G T 17: 32,820,374 P306Q probably damaging Het
Zfp831 A T 2: 174,644,185 R218W probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
R8754:Nin UTSW 12 70031013 intron probably benign
R8790:Nin UTSW 12 70021019 missense
R8974:Nin UTSW 12 70078158 missense
R9085:Nin UTSW 12 70030012 nonsense probably null
R9143:Nin UTSW 12 70090575 missense
R9380:Nin UTSW 12 70028031 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- GATCATTCTGAGGCTCCTTGAG -3'
(R):5'- CCGTTAAGTAGGGCAGAGTCAG -3'

Sequencing Primer
(F):5'- CTCATCTGGAACACTCTCT -3'
(R):5'- GAGTCAGGAAAGCATCACTCCTC -3'
Posted On 2021-08-31