Incidental Mutation 'R8950:Wdr73'
ID 681569
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R8950 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80900383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 55 (I55V)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816] [ENSMUST00000026817] [ENSMUST00000119428]
AlphaFold Q9CWR1
Predicted Effect probably benign
Transcript: ENSMUST00000026816
AA Change: I55V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: I55V

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026817
SMART Domains Protein: ENSMUSP00000026817
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119428
SMART Domains Protein: ENSMUSP00000113407
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 1.4e-12 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: I53V

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,164,326 R2508G probably benign Het
Abca14 T C 7: 120,224,372 F374S possibly damaging Het
Abca14 T A 7: 120,224,421 Y390* probably null Het
Abca9 T C 11: 110,163,380 probably null Het
Anxa1 G T 19: 20,375,298 S304* probably null Het
Aspm G A 1: 139,478,952 R1859Q probably damaging Het
Atp13a5 A T 16: 29,378,496 N14K probably damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Carm1 T A 9: 21,579,493 M219K probably damaging Het
Ccdc162 T C 10: 41,598,511 R1352G probably benign Het
Cib1 A G 7: 80,228,463 L89P probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Crebbp A G 16: 4,213,159 F22S probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Csn1s1 T C 5: 87,676,623 probably null Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Dock10 G T 1: 80,541,299 T1235N probably benign Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Fam151b A T 13: 92,474,059 M74K probably damaging Het
Fat1 T A 8: 45,023,121 F1735I probably damaging Het
Fip1l1 T G 5: 74,595,863 S505R probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm609 A T 16: 45,442,644 V44D possibly damaging Het
Gpr180 A G 14: 118,158,040 I295V probably benign Het
Gtf3c2 G A 5: 31,173,807 T175I probably damaging Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Irs1 T A 1: 82,286,931 Q1188L probably benign Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kdm5b T A 1: 134,613,926 N746K possibly damaging Het
Kdm7a T C 6: 39,146,969 I754V probably benign Het
Mad2l1bp G A 17: 46,147,965 T213I possibly damaging Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Mbd2 A G 18: 70,580,793 D231G probably damaging Het
Negr1 C A 3: 157,016,269 P160Q probably damaging Het
Nfya A T 17: 48,393,461 probably benign Het
Nlk T C 11: 78,695,932 Q112R probably benign Het
Obscn C A 11: 59,056,183 A4339S probably damaging Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Pcdhb12 A G 18: 37,437,537 T579A probably benign Het
Pcdhb2 G A 18: 37,296,662 V563M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Piezo1 T C 8: 122,481,990 R2545G probably benign Het
Plcb1 A G 2: 135,337,519 N616D probably damaging Het
Pogk A T 1: 166,398,825 F586I probably damaging Het
Prkg2 T A 5: 98,971,956 I435F possibly damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Rad17 A G 13: 100,631,068 S342P probably damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Skint5 T C 4: 113,517,152 T1247A unknown Het
Slc22a14 A G 9: 119,169,710 L182P possibly damaging Het
Slc35b3 T C 13: 38,954,121 D104G probably damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Tat T A 8: 109,991,705 I74N probably damaging Het
Trappc6a G T 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Usp44 A G 10: 93,846,267 E193G possibly damaging Het
Virma C T 4: 11,519,047 Q765* probably null Het
Vmn1r46 T C 6: 89,977,071 S301P probably damaging Het
Vmn2r116 A T 17: 23,401,493 I734F probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CATTCATCCCCATGCACAGG -3'
(R):5'- TTCCATCCCCTGACACAAGG -3'

Sequencing Primer
(F):5'- AACCTTGGATGTCCTGGAAC -3'
(R):5'- CTGACACAAGGCTACTCAGAGAATG -3'
Posted On 2021-08-31