Incidental Mutation 'R0464:Nf1'
ID71443
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 038664-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0464 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79556789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2452 (V2452A)
Ref Sequence ENSEMBL: ENSMUSP00000103886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000137997]
Predicted Effect probably benign
Transcript: ENSMUST00000071325
AA Change: V2473A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: V2473A

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108251
AA Change: V2452A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: V2452A

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137997
AA Change: V457A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120982
Gene: ENSMUSG00000020716
AA Change: V457A

DomainStartEndE-ValueType
low complexity region 604 614 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146699
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,437 L28P probably damaging Het
Ada G T 2: 163,732,964 Y84* probably null Het
Adar T A 3: 89,735,582 C257S possibly damaging Het
Adgrd1 G T 5: 129,162,650 C507F probably damaging Het
Atp5a1 T C 18: 77,779,922 Y299H probably benign Het
Bok G T 1: 93,694,213 R77L probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Ceacam1 A G 7: 25,472,017 S341P possibly damaging Het
Cfhr3 A T 1: 139,593,945 noncoding transcript Het
Ckap5 A G 2: 91,579,513 I947V probably benign Het
Clec2i T C 6: 128,895,423 Y173H probably damaging Het
Cttnbp2 T C 6: 18,408,691 D977G possibly damaging Het
Cyp2f2 C A 7: 27,132,537 Q406K probably benign Het
Ddx28 A G 8: 106,010,053 S458P probably damaging Het
Dppa3 T A 6: 122,628,533 probably null Het
Dusp10 C A 1: 184,069,076 L347I probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fbxl15 A T 19: 46,328,512 E13D probably benign Het
Fhit T A 14: 10,991,567 probably benign Het
Fras1 G T 5: 96,636,803 V882F probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabbr1 C T 17: 37,050,834 probably benign Het
Ganc T A 2: 120,436,694 V497D probably benign Het
Glt8d2 T G 10: 82,654,730 H242P possibly damaging Het
Gm906 A G 13: 50,248,275 probably benign Het
Gna15 T C 10: 81,512,504 Y131C probably benign Het
Gpatch8 T C 11: 102,480,886 K609E unknown Het
Gprc5a A T 6: 135,079,415 K287* probably null Het
Iqub T A 6: 24,479,263 K427* probably null Het
Itpr2 C G 6: 146,375,889 D666H probably damaging Het
Kcnj5 T C 9: 32,322,973 I15M possibly damaging Het
Kcnn2 A G 18: 45,560,359 E334G probably damaging Het
Lypd6 T A 2: 50,190,678 I126N probably damaging Het
Mtus1 T C 8: 41,002,474 D56G probably damaging Het
Myo1h A G 5: 114,360,510 D889G probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nab1 T C 1: 52,490,015 D241G possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncbp3 C T 11: 73,069,821 probably benign Het
Nek1 T A 8: 61,072,273 probably benign Het
Nlrp1b A C 11: 71,218,244 S144A probably damaging Het
Npr2 A T 4: 43,640,597 probably null Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC "TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC,TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC" X: 143,743,893 probably benign Het
Paox T A 7: 140,129,282 probably benign Het
Pcdh15 T A 10: 74,626,844 probably null Het
Pde8b G A 13: 95,104,698 T202M probably damaging Het
Pigo A T 4: 43,019,814 V905D probably benign Het
Pik3cb A G 9: 99,044,743 probably null Het
Rassf5 T C 1: 131,212,261 N87S probably benign Het
Rbl1 C A 2: 157,147,545 K1051N probably damaging Het
Rfx7 T C 9: 72,618,204 V892A probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf144b T A 13: 47,242,887 Y233* probably null Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sbf2 T C 7: 110,464,576 probably benign Het
Sgo2a A T 1: 58,000,094 K85N probably damaging Het
Siglec1 A T 2: 131,079,359 C631S probably damaging Het
Simc1 C T 13: 54,537,100 R50* probably null Het
Skint5 T A 4: 113,535,731 M1235L unknown Het
Slc22a19 A T 19: 7,682,913 N377K probably benign Het
Spata31d1a A G 13: 59,701,759 F852L possibly damaging Het
Srbd1 G A 17: 86,120,002 S401F probably damaging Het
Stk36 C A 1: 74,611,172 Q288K probably damaging Het
Styx T C 14: 45,372,451 S191P probably benign Het
Supt6 T A 11: 78,216,338 N1214I probably benign Het
Tcim T A 8: 24,438,628 D90V probably damaging Het
Tdpoz1 T A 3: 93,671,475 M1L probably damaging Het
Tep1 T A 14: 50,847,684 T881S probably benign Het
Tlr5 C T 1: 182,973,710 A193V probably benign Het
Tmem117 T A 15: 94,714,919 F112Y probably damaging Het
Tnrc6c C T 11: 117,760,549 R1633W probably damaging Het
Trh T C 6: 92,243,668 probably null Het
Triobp A G 15: 78,966,986 R447G possibly damaging Het
Trip6 A G 5: 137,313,681 F46S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Usp33 T C 3: 152,376,235 probably benign Het
Vmn2r60 A T 7: 42,135,831 I156F probably damaging Het
Wdr17 T C 8: 54,670,392 probably benign Het
Wdr35 G T 12: 9,027,472 probably benign Het
Wwp1 C T 4: 19,638,763 probably benign Het
Zfp652 T C 11: 95,763,649 C293R probably damaging Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Diesel UTSW 11 79556723 missense probably damaging 0.96
Franklin UTSW 11 79473320 splice site probably null
Gasoline UTSW 11 79556789 missense probably benign 0.17
jackson UTSW 11 79447572 missense probably damaging 1.00
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
R7007:Nf1 UTSW 11 79447023 intron probably null
R7066:Nf1 UTSW 11 79556720 missense probably damaging 1.00
R7099:Nf1 UTSW 11 79570330 missense probably benign 0.08
R7213:Nf1 UTSW 11 79469819 missense probably benign 0.23
R7326:Nf1 UTSW 11 79564943 missense probably benign
R7348:Nf1 UTSW 11 79536850 missense probably benign
R7380:Nf1 UTSW 11 79546276 missense probably damaging 1.00
R7407:Nf1 UTSW 11 79448143 missense probably damaging 1.00
R7412:Nf1 UTSW 11 79473414 missense probably damaging 1.00
R7545:Nf1 UTSW 11 79409524 missense probably benign
R7567:Nf1 UTSW 11 79547226 missense probably damaging 0.99
R7574:Nf1 UTSW 11 79408769 missense probably null 0.99
R7616:Nf1 UTSW 11 79384266 missense probably damaging 0.97
R7713:Nf1 UTSW 11 79425606 missense probably benign
R7737:Nf1 UTSW 11 79545488 missense probably benign 0.33
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCCTTTCAAAGCAGTCTGTAAAC -3'
(R):5'- TACTCTTGCCAGACCATCTGGAGC -3'

Sequencing Primer
(F):5'- ACTCTTGAGGATAAGTCTATCCCG -3'
(R):5'- ACCATCTGGAGCTGCCAC -3'
Posted On2013-09-30