Mutagenetix > Incidental Mutation

Incidental Mutation 'R8232:Nf1'

637187

Institutional Source

Beutler Lab

Gene Symbol

Nf1

Ensembl Gene

ENSMUSG00000020716

Gene Name

neurofibromin 1

Synonyms

Mhdadsk9, Dsk9, neurofibromin, Nf-1

MMRRC Submission

067664-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8232 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79230519-79472438 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79469157 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 806 (S806G)

Ref Sequence

ENSEMBL: ENSMUSP00000120982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000137997]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071325
AA Change: S2821G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: S2821G

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108251
AA Change: S2800G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: S2800G

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137997
AA Change: S806G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120982
Gene: ENSMUSG00000020716
AA Change: S806G

Domain	Start	End	E-Value	Type
low complexity region	604	614	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.5%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat1	A	T	4: 49,450,817 (GRCm39)	M98K	probably damaging	Het
Actn3	A	T	19: 4,921,683 (GRCm39)	W166R	probably damaging	Het
Adamts16	C	A	13: 70,941,217 (GRCm39)	C390F	probably damaging	Het
Arhgap32	A	T	9: 32,168,198 (GRCm39)	D727V	probably damaging	Het
Bcr	A	G	10: 75,001,883 (GRCm39)	Y929C	probably damaging	Het
Bmp1	T	A	14: 70,757,329 (GRCm39)	Y50F	probably damaging	Het
Camta2	G	A	11: 70,573,841 (GRCm39)	R171C	unknown	Het
Ccnd2	A	G	6: 127,127,549 (GRCm39)	L63P	probably damaging	Het
Clip1	G	C	5: 123,785,981 (GRCm39)	D234E	probably benign	Het
Dnah9	A	T	11: 65,746,149 (GRCm39)	I3988N	possibly damaging	Het
Frmpd2	T	G	14: 33,261,724 (GRCm39)	I843S	probably damaging	Het
Gcgr	A	G	11: 120,427,328 (GRCm39)	Y146C	probably damaging	Het
Gm5930	T	G	14: 44,573,181 (GRCm39)	K158T	probably damaging	Het
Gnl1	T	A	17: 36,298,487 (GRCm39)	C410*	probably null	Het
Gtf2h1	T	A	7: 46,451,103 (GRCm39)	I4K	probably benign	Het
Il12b	A	G	11: 44,299,401 (GRCm39)	S157G	possibly damaging	Het
Jcad	G	T	18: 4,674,862 (GRCm39)	A875S	probably benign	Het
Kcnrg	T	A	14: 61,845,386 (GRCm39)	M142K	probably benign	Het
Krtap4-6	A	C	11: 99,556,568 (GRCm39)	L53R	unknown	Het
Myo10	G	A	15: 25,804,400 (GRCm39)	G1565D	possibly damaging	Het
Nlrp5	G	T	7: 23,116,770 (GRCm39)	V165L	probably benign	Het
Nppa	T	C	4: 148,085,795 (GRCm39)	I134T	possibly damaging	Het
Or4a72	A	T	2: 89,405,938 (GRCm39)	V44E	noncoding transcript	Het
Or51ai2	G	A	7: 103,586,980 (GRCm39)	R131Q	possibly damaging	Het
Or5b107	A	G	19: 13,142,683 (GRCm39)	M102V	probably benign	Het
Or5p68	A	T	7: 107,945,495 (GRCm39)	M231K	probably damaging	Het
Or6c202	C	A	10: 128,996,097 (GRCm39)	C252F	probably damaging	Het
Scyl2	A	T	10: 89,498,309 (GRCm39)	F167I	probably damaging	Het
Smarcal1	T	C	1: 72,665,722 (GRCm39)	L740S	probably damaging	Het
Tmem183a	T	A	1: 134,277,918 (GRCm39)	D282V	probably damaging	Het
Trhde	A	T	10: 114,636,442 (GRCm39)	V255E	possibly damaging	Het
Vmn1r229	T	A	17: 21,035,309 (GRCm39)	C185S	probably damaging	Het
Vmn2r58	A	T	7: 41,514,076 (GRCm39)	M189K	probably damaging	Het
Vps50	T	G	6: 3,600,139 (GRCm39)	V866G	probably damaging	Het

Other mutations in Nf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Nf1	APN	11	79,286,731 (GRCm39)	missense	probably damaging	0.99
IGL00801:Nf1	APN	11	79,319,526 (GRCm39)	splice site	probably benign
IGL00823:Nf1	APN	11	79,456,343 (GRCm39)	missense	probably damaging	1.00
IGL00945:Nf1	APN	11	79,360,629 (GRCm39)	missense	probably damaging	0.99
IGL00960:Nf1	APN	11	79,335,947 (GRCm39)	missense	probably damaging	1.00
IGL01118:Nf1	APN	11	79,437,812 (GRCm39)	missense	probably damaging	0.99
IGL01604:Nf1	APN	11	79,332,535 (GRCm39)	splice site	probably benign
IGL01637:Nf1	APN	11	79,437,946 (GRCm39)	missense	probably damaging	1.00
IGL01659:Nf1	APN	11	79,450,275 (GRCm39)	missense	probably benign
IGL01764:Nf1	APN	11	79,275,013 (GRCm39)	missense	probably benign
IGL01772:Nf1	APN	11	79,281,075 (GRCm39)	missense	probably damaging	1.00
IGL02047:Nf1	APN	11	79,316,361 (GRCm39)	missense	probably benign	0.04
IGL02052:Nf1	APN	11	79,303,553 (GRCm39)	missense	probably damaging	1.00
IGL02071:Nf1	APN	11	79,334,947 (GRCm39)	missense	possibly damaging	0.96
IGL02312:Nf1	APN	11	79,335,474 (GRCm39)	missense	possibly damaging	0.95
IGL02341:Nf1	APN	11	79,455,752 (GRCm39)	missense	probably benign	0.33
IGL02390:Nf1	APN	11	79,456,761 (GRCm39)	missense	possibly damaging	0.64
IGL02390:Nf1	APN	11	79,302,502 (GRCm39)	splice site	probably benign
IGL02475:Nf1	APN	11	79,426,493 (GRCm39)	missense	probably damaging	1.00
IGL02567:Nf1	APN	11	79,437,969 (GRCm39)	missense	probably damaging	1.00
IGL02571:Nf1	APN	11	79,319,453 (GRCm39)	missense	probably damaging	1.00
IGL02664:Nf1	APN	11	79,335,424 (GRCm39)	critical splice acceptor site	probably null
IGL02664:Nf1	APN	11	79,335,425 (GRCm39)	critical splice acceptor site	probably null
IGL02992:Nf1	APN	11	79,325,759 (GRCm39)	splice site	probably benign
IGL03006:Nf1	APN	11	79,436,257 (GRCm39)	missense	probably damaging	1.00
IGL03216:Nf1	APN	11	79,455,721 (GRCm39)	missense	probably benign	0.17
Diesel	UTSW	11	79,447,549 (GRCm39)	missense	probably damaging	0.96
Eyecandy	UTSW	11	79,436,291 (GRCm39)	missense	probably damaging	1.00
Franklin	UTSW	11	79,364,146 (GRCm39)	splice site	probably null
Gasoline	UTSW	11	79,447,615 (GRCm39)	missense	probably benign	0.17
hancock	UTSW	11	79,427,676 (GRCm39)	missense	probably benign
independence	UTSW	11	79,345,136 (GRCm39)	intron	probably benign
jackson	UTSW	11	79,338,398 (GRCm39)	missense	probably damaging	1.00
Jefferson	UTSW	11	79,337,690 (GRCm39)	missense	probably damaging	1.00
Phyletic_dwarf	UTSW	11	79,345,015 (GRCm39)	missense	probably damaging	1.00
responsibility	UTSW	11	79,456,801 (GRCm39)	missense	probably damaging	0.99
weepy	UTSW	11	79,437,812 (GRCm39)	missense	probably damaging	1.00
C9142:Nf1	UTSW	11	79,447,557 (GRCm39)	missense	probably damaging	0.98
I2289:Nf1	UTSW	11	79,438,602 (GRCm39)	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79,362,377 (GRCm39)	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79,362,377 (GRCm39)	missense	probably damaging	1.00
R0081:Nf1	UTSW	11	79,344,805 (GRCm39)	splice site	probably benign
R0115:Nf1	UTSW	11	79,359,702 (GRCm39)	critical splice donor site	probably null
R0144:Nf1	UTSW	11	79,437,953 (GRCm39)	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79,469,098 (GRCm39)	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79,359,595 (GRCm39)	missense	possibly damaging	0.94
R0217:Nf1	UTSW	11	79,319,400 (GRCm39)	splice site	probably benign
R0238:Nf1	UTSW	11	79,309,400 (GRCm39)	missense	possibly damaging	0.89
R0238:Nf1	UTSW	11	79,309,400 (GRCm39)	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79,309,400 (GRCm39)	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79,309,400 (GRCm39)	missense	possibly damaging	0.89
R0255:Nf1	UTSW	11	79,299,525 (GRCm39)	splice site	probably null
R0362:Nf1	UTSW	11	79,427,704 (GRCm39)	missense	probably damaging	1.00
R0364:Nf1	UTSW	11	79,332,783 (GRCm39)	nonsense	probably null
R0464:Nf1	UTSW	11	79,447,615 (GRCm39)	missense	probably benign	0.17
R0511:Nf1	UTSW	11	79,329,595 (GRCm39)	missense	probably benign	0.01
R0549:Nf1	UTSW	11	79,359,597 (GRCm39)	missense	probably damaging	0.99
R0585:Nf1	UTSW	11	79,459,527 (GRCm39)	missense	probably damaging	0.99
R0636:Nf1	UTSW	11	79,426,529 (GRCm39)	missense	probably damaging	0.99
R0924:Nf1	UTSW	11	79,344,692 (GRCm39)	missense	probably damaging	0.98
R0942:Nf1	UTSW	11	79,329,537 (GRCm39)	missense	probably benign	0.00
R1022:Nf1	UTSW	11	79,437,859 (GRCm39)	missense	probably damaging	1.00
R1024:Nf1	UTSW	11	79,437,859 (GRCm39)	missense	probably damaging	1.00
R1350:Nf1	UTSW	11	79,303,513 (GRCm39)	missense	probably damaging	1.00
R1365:Nf1	UTSW	11	79,438,711 (GRCm39)	splice site	probably null
R1395:Nf1	UTSW	11	79,426,809 (GRCm39)	missense	possibly damaging	0.49
R1467:Nf1	UTSW	11	79,319,452 (GRCm39)	missense	possibly damaging	0.88
R1467:Nf1	UTSW	11	79,319,452 (GRCm39)	missense	possibly damaging	0.88
R1477:Nf1	UTSW	11	79,286,685 (GRCm39)	nonsense	probably null
R1508:Nf1	UTSW	11	79,331,735 (GRCm39)	missense	probably damaging	1.00
R1512:Nf1	UTSW	11	79,281,195 (GRCm39)	missense	probably damaging	1.00
R1605:Nf1	UTSW	11	79,331,749 (GRCm39)	missense	probably benign	0.01
R1680:Nf1	UTSW	11	79,441,824 (GRCm39)	nonsense	probably null
R1704:Nf1	UTSW	11	79,354,127 (GRCm39)	splice site	probably null
R1707:Nf1	UTSW	11	79,426,430 (GRCm39)	missense	probably damaging	1.00
R1741:Nf1	UTSW	11	79,334,757 (GRCm39)	missense	probably benign
R1761:Nf1	UTSW	11	79,275,091 (GRCm39)	missense	probably damaging	1.00
R1800:Nf1	UTSW	11	79,444,794 (GRCm39)	missense	possibly damaging	0.94
R1873:Nf1	UTSW	11	79,437,987 (GRCm39)	missense	probably damaging	1.00
R1966:Nf1	UTSW	11	79,302,390 (GRCm39)	missense	possibly damaging	0.72
R1967:Nf1	UTSW	11	79,303,571 (GRCm39)	missense	probably damaging	0.96
R1970:Nf1	UTSW	11	79,444,787 (GRCm39)	missense	probably benign	0.08
R2059:Nf1	UTSW	11	79,447,549 (GRCm39)	missense	probably damaging	0.96
R2105:Nf1	UTSW	11	79,360,652 (GRCm39)	missense	possibly damaging	0.50
R2151:Nf1	UTSW	11	79,338,396 (GRCm39)	missense	possibly damaging	0.94
R2211:Nf1	UTSW	11	79,334,890 (GRCm39)	missense	probably benign	0.39
R2497:Nf1	UTSW	11	79,334,710 (GRCm39)	missense	probably damaging	1.00
R2899:Nf1	UTSW	11	79,303,584 (GRCm39)	missense	possibly damaging	0.93
R3086:Nf1	UTSW	11	79,437,812 (GRCm39)	missense	probably damaging	1.00
R3120:Nf1	UTSW	11	79,455,725 (GRCm39)	missense	probably damaging	0.99
R3744:Nf1	UTSW	11	79,439,573 (GRCm39)	missense	probably benign	0.23
R3801:Nf1	UTSW	11	79,450,347 (GRCm39)	missense	probably null	0.98
R3804:Nf1	UTSW	11	79,450,347 (GRCm39)	missense	probably null	0.98
R4212:Nf1	UTSW	11	79,360,624 (GRCm39)	missense	probably damaging	1.00
R4298:Nf1	UTSW	11	79,275,070 (GRCm39)	missense	probably damaging	1.00
R4578:Nf1	UTSW	11	79,336,585 (GRCm39)	missense	probably damaging	1.00
R4579:Nf1	UTSW	11	79,359,583 (GRCm39)	missense	probably damaging	1.00
R4587:Nf1	UTSW	11	79,426,863 (GRCm39)	critical splice donor site	probably null
R4793:Nf1	UTSW	11	79,338,398 (GRCm39)	missense	probably damaging	1.00
R4834:Nf1	UTSW	11	79,437,123 (GRCm39)	missense	probably damaging	1.00
R4863:Nf1	UTSW	11	79,300,235 (GRCm39)	missense	probably damaging	1.00
R4967:Nf1	UTSW	11	79,456,379 (GRCm39)	critical splice donor site	probably null
R4971:Nf1	UTSW	11	79,335,469 (GRCm39)	missense	probably damaging	1.00
R5034:Nf1	UTSW	11	79,334,976 (GRCm39)	missense	probably damaging	0.98
R5036:Nf1	UTSW	11	79,337,690 (GRCm39)	missense	probably damaging	1.00
R5207:Nf1	UTSW	11	79,345,015 (GRCm39)	missense	probably damaging	1.00
R5348:Nf1	UTSW	11	79,455,725 (GRCm39)	missense	probably damaging	1.00
R5356:Nf1	UTSW	11	79,364,282 (GRCm39)	missense	possibly damaging	0.94
R5444:Nf1	UTSW	11	79,334,785 (GRCm39)	missense	possibly damaging	0.94
R5533:Nf1	UTSW	11	79,336,615 (GRCm39)	missense	probably damaging	0.99
R5918:Nf1	UTSW	11	79,460,048 (GRCm39)	intron	probably benign
R5978:Nf1	UTSW	11	79,431,245 (GRCm39)	missense	probably damaging	1.00
R6140:Nf1	UTSW	11	79,364,146 (GRCm39)	splice site	probably null
R6195:Nf1	UTSW	11	79,456,801 (GRCm39)	missense	probably damaging	0.99
R6216:Nf1	UTSW	11	79,302,433 (GRCm39)	missense	possibly damaging	0.93
R6233:Nf1	UTSW	11	79,456,801 (GRCm39)	missense	probably damaging	0.99
R6257:Nf1	UTSW	11	79,440,317 (GRCm39)	missense	probably damaging	1.00
R6258:Nf1	UTSW	11	79,456,581 (GRCm39)	splice site	probably null
R6756:Nf1	UTSW	11	79,335,413 (GRCm39)	splice site	probably null
R6878:Nf1	UTSW	11	79,325,708 (GRCm39)	missense	probably damaging	1.00
R6959:Nf1	UTSW	11	79,440,294 (GRCm39)	missense	probably damaging	0.98
R7007:Nf1	UTSW	11	79,337,849 (GRCm39)	splice site	probably null
R7066:Nf1	UTSW	11	79,447,546 (GRCm39)	missense	probably damaging	1.00
R7099:Nf1	UTSW	11	79,461,156 (GRCm39)	missense	probably benign	0.08
R7213:Nf1	UTSW	11	79,360,645 (GRCm39)	missense	probably benign	0.23
R7326:Nf1	UTSW	11	79,455,769 (GRCm39)	missense	probably benign
R7348:Nf1	UTSW	11	79,427,676 (GRCm39)	missense	probably benign
R7380:Nf1	UTSW	11	79,437,102 (GRCm39)	missense	probably damaging	1.00
R7407:Nf1	UTSW	11	79,338,969 (GRCm39)	missense	probably damaging	1.00
R7412:Nf1	UTSW	11	79,364,240 (GRCm39)	missense	probably damaging	1.00
R7545:Nf1	UTSW	11	79,300,350 (GRCm39)	missense	probably benign
R7567:Nf1	UTSW	11	79,438,052 (GRCm39)	missense	probably damaging	0.99
R7574:Nf1	UTSW	11	79,299,595 (GRCm39)	missense	probably null	0.99
R7616:Nf1	UTSW	11	79,275,092 (GRCm39)	missense	probably damaging	0.97
R7713:Nf1	UTSW	11	79,316,432 (GRCm39)	missense	probably benign
R7737:Nf1	UTSW	11	79,436,314 (GRCm39)	missense	probably benign	0.33
R7869:Nf1	UTSW	11	79,309,414 (GRCm39)	missense	probably damaging	1.00
R7905:Nf1	UTSW	11	79,437,938 (GRCm39)	missense	possibly damaging	0.80
R8244:Nf1	UTSW	11	79,331,750 (GRCm39)	missense	probably benign
R8397:Nf1	UTSW	11	79,438,518 (GRCm39)	missense	probably damaging	1.00
R8436:Nf1	UTSW	11	79,349,709 (GRCm39)	missense	probably damaging	0.99
R8492:Nf1	UTSW	11	79,299,248 (GRCm39)	missense	probably benign	0.06
R8719:Nf1	UTSW	11	79,281,119 (GRCm39)	missense	possibly damaging	0.86
R8735:Nf1	UTSW	11	79,345,136 (GRCm39)	intron	probably benign
R8795:Nf1	UTSW	11	79,316,442 (GRCm39)	missense	probably damaging	1.00
R8797:Nf1	UTSW	11	79,366,711 (GRCm39)	critical splice donor site	probably benign
R8809:Nf1	UTSW	11	79,437,964 (GRCm39)	missense	probably damaging	0.99
R8812:Nf1	UTSW	11	79,437,180 (GRCm39)	missense	probably damaging	0.96
R8815:Nf1	UTSW	11	79,332,491 (GRCm39)	missense	probably damaging	1.00
R8828:Nf1	UTSW	11	79,286,679 (GRCm39)	critical splice acceptor site	probably null
R8894:Nf1	UTSW	11	79,336,619 (GRCm39)	missense	probably damaging	1.00
R9051:Nf1	UTSW	11	79,364,168 (GRCm39)	missense	probably damaging	1.00
R9103:Nf1	UTSW	11	79,450,332 (GRCm39)	missense	probably damaging	0.99
R9142:Nf1	UTSW	11	79,366,688 (GRCm39)	missense	probably damaging	1.00
R9142:Nf1	UTSW	11	79,362,315 (GRCm39)	missense	probably damaging	1.00
R9170:Nf1	UTSW	11	79,436,291 (GRCm39)	missense	probably damaging	1.00
R9201:Nf1	UTSW	11	79,461,156 (GRCm39)	missense	probably benign	0.08
R9267:Nf1	UTSW	11	79,331,716 (GRCm39)	missense	possibly damaging	0.72
R9309:Nf1	UTSW	11	79,359,595 (GRCm39)	missense	possibly damaging	0.94
R9340:Nf1	UTSW	11	79,447,629 (GRCm39)	missense	possibly damaging	0.90
R9398:Nf1	UTSW	11	79,438,018 (GRCm39)	missense	probably damaging	0.99
R9471:Nf1	UTSW	11	79,436,195 (GRCm39)	missense	probably damaging	0.99
R9630:Nf1	UTSW	11	79,302,470 (GRCm39)	missense	probably damaging	1.00
R9664:Nf1	UTSW	11	79,334,733 (GRCm39)	missense	probably damaging	1.00
X0052:Nf1	UTSW	11	79,450,242 (GRCm39)	missense	probably damaging	0.99
Z1177:Nf1	UTSW	11	79,455,751 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTGGCAGTTTACTGTGAATG -3'
(R):5'- CAATGCTCCAAGAGATGACCG -3'

Sequencing Primer
(F):5'- CTGGGACTGCTCACCATTC -3'
(R):5'- TCCAAGAGATGACCGTCTGG -3'

Posted On

2020-07-13