Mutagenetix > Incidental Mutation

Incidental Mutation 'R5207:Nf1'

402096

Institutional Source

Beutler Lab

Gene Symbol

Nf1

Ensembl Gene

ENSMUSG00000020716

Gene Name

neurofibromin 1

Synonyms

Nf-1, neurofibromin

MMRRC Submission

042782-MU

Accession Numbers

Genbank: NM_010897; MGI: 97306

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79339693-79581612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 79454189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1323 (V1323L)

Ref Sequence

ENSEMBL: ENSMUSP00000103886 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071325
AA Change: V1323L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: V1323L

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108251
AA Change: V1323L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: V1323L

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118691

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130979

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219057
AA Change: V1333L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.2110

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahctf1	A	T	1: 179,793,594		probably benign	Het
Alg6	C	T	4: 99,719,194	L15F	possibly damaging	Het
Allc	T	A	12: 28,555,326	M325L	probably benign	Het
Ap3b2	T	C	7: 81,476,769	N361S	possibly damaging	Het
Bmp8b	A	G	4: 123,115,921		probably benign	Het
Borcs6	A	T	11: 69,060,848	T351S	probably damaging	Het
Casc1	A	T	6: 145,179,068	D510E	probably damaging	Het
Ccar1	T	C	10: 62,753,281	R808G	unknown	Het
Celsr3	A	T	9: 108,832,759	T1480S	probably benign	Het
Chdh	C	T	14: 30,031,361	P76S	probably damaging	Het
Chmp7	T	C	14: 69,732,306	S62G	probably benign	Het
Cldn23	A	T	8: 35,826,028	V102E	probably damaging	Het
Csn2	G	A	5: 87,694,962	Q69*	probably null	Het
Ctrc	A	C	4: 141,840,384	I136S	probably damaging	Het
Cysltr2	A	C	14: 73,029,511	L253R	probably damaging	Het
Ddr2	G	A	1: 169,984,961	T654M	probably damaging	Het
Derl2	G	T	11: 71,019,247		probably null	Het
Dock5	T	C	14: 67,776,284	S1330G	probably benign	Het
Emp3	T	C	7: 45,919,949	N56S	probably benign	Het
Fam161a	A	T	11: 23,020,583	K195*	probably null	Het
Fam71b	T	C	11: 46,405,163	S121P	probably benign	Het
Ficd	T	A	5: 113,737,011	V47E	probably benign	Het
Gbp10	T	C	5: 105,224,709	T123A	probably benign	Het
Gdf7	C	T	12: 8,298,371	A309T	unknown	Het
Gm14486	G	T	2: 30,658,560		noncoding transcript	Het
Herc1	T	A	9: 66,399,869	C990*	probably null	Het
Itgb4	T	C	11: 116,006,539	V1530A	probably damaging	Het
Itpka	G	A	2: 119,750,493	R374H	probably damaging	Het
Lacc1	T	A	14: 77,034,154		probably null	Het
Med23	A	T	10: 24,895,836	K225*	probably null	Het
Mrgpra3	T	A	7: 47,590,161	T6S	probably benign	Het
Mroh7	T	A	4: 106,721,386	N32Y	probably damaging	Het
Mrps2	A	G	2: 28,469,751	R207G	probably damaging	Het
Mup20	A	C	4: 62,051,586		probably null	Het
Nagpa	A	G	16: 5,199,614		probably null	Het
Nek3	A	T	8: 22,132,227		probably benign	Het
Nes	G	A	3: 87,978,628	G1398E	probably damaging	Het
Olfr1416	A	T	1: 92,479,872	F250I	probably benign	Het
Olfr1446	T	A	19: 12,890,437	I47F	probably benign	Het
Olfr791	T	C	10: 129,526,904	F226L	probably benign	Het
Paqr8	G	T	1: 20,935,258	C212F	probably benign	Het
Pcdhb1	T	C	18: 37,266,462	Y489H	probably damaging	Het
Piwil2	T	C	14: 70,392,517	K683E	probably damaging	Het
Pjvk	A	C	2: 76,650,390		probably null	Het
Pkd1l3	A	T	8: 109,633,191	S893C	probably damaging	Het
Plxna2	A	G	1: 194,788,899	T993A	probably benign	Het
Ppp2r2b	A	T	18: 42,688,352	I247N	probably damaging	Het
Rac2	T	C	15: 78,565,454	N92S	probably damaging	Het
Senp2	A	T	16: 22,041,380	H501L	possibly damaging	Het
Snx29	A	T	16: 11,738,363	I753F	probably damaging	Het
Tcf20	T	A	15: 82,856,185	H355L	probably damaging	Het
Tex2	T	C	11: 106,546,840	D668G	unknown	Het
Tlr12	G	A	4: 128,616,709	Q583*	probably null	Het
Tmem119	T	C	5: 113,795,228	I171V	probably damaging	Het
Ube2m	C	T	7: 13,036,322		probably null	Het
Vmn2r25	A	T	6: 123,840,103	I173N	probably damaging	Het
Whrn	A	T	4: 63,432,714	V15E	probably damaging	Het
Zfp558	A	C	9: 18,457,000	V164G	possibly damaging	Het

Other mutations in Nf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Nf1	APN	11	79395905	missense	probably damaging	0.99
IGL00801:Nf1	APN	11	79428700	splice site	probably benign
IGL00823:Nf1	APN	11	79565517	missense	probably damaging	1.00
IGL00945:Nf1	APN	11	79469803	missense	probably damaging	0.99
IGL00960:Nf1	APN	11	79445121	missense	probably damaging	1.00
IGL01118:Nf1	APN	11	79546986	missense	probably damaging	0.99
IGL01604:Nf1	APN	11	79441709	splice site	probably benign
IGL01637:Nf1	APN	11	79547120	missense	probably damaging	1.00
IGL01659:Nf1	APN	11	79559449	missense	probably benign
IGL01764:Nf1	APN	11	79384187	missense	probably benign
IGL01772:Nf1	APN	11	79390249	missense	probably damaging	1.00
IGL02047:Nf1	APN	11	79425535	missense	probably benign	0.04
IGL02052:Nf1	APN	11	79412727	missense	probably damaging	1.00
IGL02071:Nf1	APN	11	79444121	missense	possibly damaging	0.96
IGL02312:Nf1	APN	11	79444648	missense	possibly damaging	0.95
IGL02341:Nf1	APN	11	79564926	missense	probably benign	0.33
IGL02390:Nf1	APN	11	79565935	missense	possibly damaging	0.64
IGL02390:Nf1	APN	11	79411676	splice site	probably benign
IGL02475:Nf1	APN	11	79535667	missense	probably damaging	1.00
IGL02567:Nf1	APN	11	79547143	missense	probably damaging	1.00
IGL02571:Nf1	APN	11	79428627	missense	probably damaging	1.00
IGL02664:Nf1	APN	11	79444598	critical splice acceptor site	probably null
IGL02664:Nf1	APN	11	79444599	critical splice acceptor site	probably null
IGL02992:Nf1	APN	11	79434933	splice site	probably benign
IGL03006:Nf1	APN	11	79545431	missense	probably damaging	1.00
IGL03216:Nf1	APN	11	79564895	missense	probably benign	0.17
Diesel	UTSW	11	79556723	missense	probably damaging	0.96
Eyecandy	UTSW	11	79545465	missense	probably damaging	1.00
Franklin	UTSW	11	79473320	splice site	probably null
Gasoline	UTSW	11	79556789	missense	probably benign	0.17
hancock	UTSW	11	79536850	missense	probably benign
independence	UTSW	11	79454310	intron	probably benign
jackson	UTSW	11	79447572	missense	probably damaging	1.00
Jefferson	UTSW	11	79446864	missense	probably damaging	1.00
Phyletic_dwarf	UTSW	11	79454189	missense	probably damaging	1.00
responsibility	UTSW	11	79565975	missense	probably damaging	0.99
weepy	UTSW	11	79546986	missense	probably damaging	1.00
C9142:Nf1	UTSW	11	79556731	missense	probably damaging	0.98
I2289:Nf1	UTSW	11	79547776	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0081:Nf1	UTSW	11	79453979	splice site	probably benign
R0115:Nf1	UTSW	11	79468876	critical splice donor site	probably null
R0144:Nf1	UTSW	11	79547127	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R0196:Nf1	UTSW	11	79578272	missense	probably damaging	1.00
R0217:Nf1	UTSW	11	79428574	splice site	probably benign
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0255:Nf1	UTSW	11	79408699	splice site	probably null
R0362:Nf1	UTSW	11	79536878	missense	probably damaging	1.00
R0364:Nf1	UTSW	11	79441957	nonsense	probably null
R0464:Nf1	UTSW	11	79556789	missense	probably benign	0.17
R0511:Nf1	UTSW	11	79438769	missense	probably benign	0.01
R0549:Nf1	UTSW	11	79468771	missense	probably damaging	0.99
R0585:Nf1	UTSW	11	79568701	missense	probably damaging	0.99
R0636:Nf1	UTSW	11	79535703	missense	probably damaging	0.99
R0924:Nf1	UTSW	11	79453866	missense	probably damaging	0.98
R0942:Nf1	UTSW	11	79438711	missense	probably benign	0.00
R1022:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1024:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1350:Nf1	UTSW	11	79412687	missense	probably damaging	1.00
R1365:Nf1	UTSW	11	79547885	splice site	probably null
R1395:Nf1	UTSW	11	79535983	missense	possibly damaging	0.49
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1477:Nf1	UTSW	11	79395859	nonsense	probably null
R1508:Nf1	UTSW	11	79440909	missense	probably damaging	1.00
R1512:Nf1	UTSW	11	79390369	missense	probably damaging	1.00
R1605:Nf1	UTSW	11	79440923	missense	probably benign	0.01
R1680:Nf1	UTSW	11	79550998	nonsense	probably null
R1704:Nf1	UTSW	11	79463301	splice site	probably null
R1707:Nf1	UTSW	11	79535604	missense	probably damaging	1.00
R1741:Nf1	UTSW	11	79443931	missense	probably benign
R1761:Nf1	UTSW	11	79384265	missense	probably damaging	1.00
R1800:Nf1	UTSW	11	79553968	missense	possibly damaging	0.94
R1873:Nf1	UTSW	11	79547161	missense	probably damaging	1.00
R1966:Nf1	UTSW	11	79411564	missense	possibly damaging	0.72
R1967:Nf1	UTSW	11	79412745	missense	probably damaging	0.96
R1970:Nf1	UTSW	11	79553961	missense	probably benign	0.08
R2059:Nf1	UTSW	11	79556723	missense	probably damaging	0.96
R2105:Nf1	UTSW	11	79469826	missense	possibly damaging	0.50
R2151:Nf1	UTSW	11	79447570	missense	possibly damaging	0.94
R2211:Nf1	UTSW	11	79444064	missense	probably benign	0.39
R2497:Nf1	UTSW	11	79443884	missense	probably damaging	1.00
R2899:Nf1	UTSW	11	79412758	missense	possibly damaging	0.93
R3086:Nf1	UTSW	11	79546986	missense	probably damaging	1.00
R3120:Nf1	UTSW	11	79564899	missense	probably damaging	0.99
R3744:Nf1	UTSW	11	79548747	missense	probably benign	0.23
R3801:Nf1	UTSW	11	79559521	missense	probably null	0.98
R3804:Nf1	UTSW	11	79559521	missense	probably null	0.98
R4212:Nf1	UTSW	11	79469798	missense	probably damaging	1.00
R4298:Nf1	UTSW	11	79384244	missense	probably damaging	1.00
R4578:Nf1	UTSW	11	79445759	missense	probably damaging	1.00
R4579:Nf1	UTSW	11	79468757	missense	probably damaging	1.00
R4587:Nf1	UTSW	11	79536037	critical splice donor site	probably null
R4793:Nf1	UTSW	11	79447572	missense	probably damaging	1.00
R4834:Nf1	UTSW	11	79546297	missense	probably damaging	1.00
R4863:Nf1	UTSW	11	79409409	missense	probably damaging	1.00
R4967:Nf1	UTSW	11	79565553	critical splice donor site	probably null
R4971:Nf1	UTSW	11	79444643	missense	probably damaging	1.00
R5034:Nf1	UTSW	11	79444150	missense	probably damaging	0.98
R5036:Nf1	UTSW	11	79446864	missense	probably damaging	1.00
R5348:Nf1	UTSW	11	79564899	missense	probably damaging	1.00
R5356:Nf1	UTSW	11	79473456	missense	possibly damaging	0.94
R5444:Nf1	UTSW	11	79443959	missense	possibly damaging	0.94
R5533:Nf1	UTSW	11	79445789	missense	probably damaging	0.99
R5918:Nf1	UTSW	11	79569222	intron	probably benign
R5978:Nf1	UTSW	11	79540419	missense	probably damaging	1.00
R6140:Nf1	UTSW	11	79473320	splice site	probably null
R6195:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6216:Nf1	UTSW	11	79411607	missense	possibly damaging	0.93
R6233:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6257:Nf1	UTSW	11	79549491	missense	probably damaging	1.00
R6258:Nf1	UTSW	11	79565755	splice site	probably null
R6756:Nf1	UTSW	11	79444587	splice site	probably null
R6878:Nf1	UTSW	11	79434882	missense	probably damaging	1.00
R6959:Nf1	UTSW	11	79549468	missense	probably damaging	0.98
R7007:Nf1	UTSW	11	79447023	splice site	probably null
R7066:Nf1	UTSW	11	79556720	missense	probably damaging	1.00
R7099:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R7213:Nf1	UTSW	11	79469819	missense	probably benign	0.23
R7326:Nf1	UTSW	11	79564943	missense	probably benign
R7348:Nf1	UTSW	11	79536850	missense	probably benign
R7380:Nf1	UTSW	11	79546276	missense	probably damaging	1.00
R7407:Nf1	UTSW	11	79448143	missense	probably damaging	1.00
R7412:Nf1	UTSW	11	79473414	missense	probably damaging	1.00
R7545:Nf1	UTSW	11	79409524	missense	probably benign
R7567:Nf1	UTSW	11	79547226	missense	probably damaging	0.99
R7574:Nf1	UTSW	11	79408769	missense	probably null	0.99
R7616:Nf1	UTSW	11	79384266	missense	probably damaging	0.97
R7713:Nf1	UTSW	11	79425606	missense	probably benign
R7737:Nf1	UTSW	11	79545488	missense	probably benign	0.33
R7869:Nf1	UTSW	11	79418588	missense	probably damaging	1.00
R7905:Nf1	UTSW	11	79547112	missense	possibly damaging	0.80
R8232:Nf1	UTSW	11	79578331	missense	probably damaging	0.96
R8244:Nf1	UTSW	11	79440924	missense	probably benign
R8397:Nf1	UTSW	11	79547692	missense	probably damaging	1.00
R8436:Nf1	UTSW	11	79458883	missense	probably damaging	0.99
R8492:Nf1	UTSW	11	79408422	missense	probably benign	0.06
R8719:Nf1	UTSW	11	79390293	missense	possibly damaging	0.86
R8735:Nf1	UTSW	11	79454310	intron	probably benign
R8795:Nf1	UTSW	11	79425616	missense	probably damaging	1.00
R8797:Nf1	UTSW	11	79475885	critical splice donor site	probably benign
R8809:Nf1	UTSW	11	79547138	missense	probably damaging	0.99
R8812:Nf1	UTSW	11	79546354	missense	probably damaging	0.96
R8815:Nf1	UTSW	11	79441665	missense	probably damaging	1.00
R8828:Nf1	UTSW	11	79395853	critical splice acceptor site	probably null
R8894:Nf1	UTSW	11	79445793	missense	probably damaging	1.00
R9051:Nf1	UTSW	11	79473342	missense	probably damaging	1.00
R9103:Nf1	UTSW	11	79559506	missense	probably damaging	0.99
R9142:Nf1	UTSW	11	79471489	missense	probably damaging	1.00
R9142:Nf1	UTSW	11	79475862	missense	probably damaging	1.00
R9170:Nf1	UTSW	11	79545465	missense	probably damaging	1.00
R9201:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R9267:Nf1	UTSW	11	79440890	missense	possibly damaging	0.72
R9309:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R9340:Nf1	UTSW	11	79556803	missense	possibly damaging	0.90
R9398:Nf1	UTSW	11	79547192	missense	probably damaging	0.99
R9471:Nf1	UTSW	11	79545369	missense	probably damaging	0.99
R9630:Nf1	UTSW	11	79411644	missense	probably damaging	1.00
R9664:Nf1	UTSW	11	79443907	missense	probably damaging	1.00
X0052:Nf1	UTSW	11	79559416	missense	probably damaging	0.99
Z1177:Nf1	UTSW	11	79564925	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTCAAGGTTGGTGTCATTGAC -3'
(R):5'- TATAGCCCCAGGAGAGTGAG -3'

Sequencing Primer
(F):5'- CACACGTGCACTAGGTTTGTTGAG -3'
(R):5'- CAGGAGAGTGAGCCACGTC -3'

Posted On

2016-07-22