Incidental Mutation 'R9614:Atp13a4'
ID 724478
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 9330174J19Rik, 4631413J11Rik
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9614 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29395853-29544864 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29441580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 560 (V560A)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000039090
AA Change: V579A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: V579A

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: V560A

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182168
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000182627
AA Change: V579A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: V579A

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,364 T317I possibly damaging Het
Adamts7 T A 9: 90,195,198 V1306E probably damaging Het
Adcy9 C T 16: 4,288,683 D1093N probably damaging Het
Adgra3 A G 5: 50,006,908 V243A probably damaging Het
Aqp4 C T 18: 15,393,630 A265T probably benign Het
Atad2 A T 15: 58,106,723 probably null Het
Best2 A C 8: 85,013,422 C38G Het
Bicra A T 7: 15,971,955 S1520R probably damaging Het
C1s2 A G 6: 124,625,629 L541P probably damaging Het
Calcoco2 T A 11: 96,100,359 H184L probably benign Het
Cav1 A T 6: 17,339,404 I163F probably benign Het
Ccdc151 T C 9: 21,993,014 D322G probably benign Het
Cep57l1 T C 10: 41,721,567 H356R probably damaging Het
Clu A C 14: 65,971,402 H32P unknown Het
Col5a1 T A 2: 27,989,174 D840E unknown Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Csmd1 C A 8: 16,158,225 V1239L probably benign Het
Cubn T A 2: 13,478,134 Q267L probably benign Het
Cul7 C T 17: 46,664,286 R1689W probably damaging Het
Dao A T 5: 114,013,999 D126V probably benign Het
Eif3l T C 15: 79,094,223 M560T probably benign Het
F830016B08Rik T A 18: 60,300,307 I154N probably damaging Het
Fam184a T C 10: 53,641,048 E980G probably damaging Het
Fgf21 T C 7: 45,615,279 T10A probably benign Het
Fhad1 A C 4: 141,951,571 V598G possibly damaging Het
Foxc1 A T 13: 31,807,880 I225F possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Galnt9 G A 5: 110,596,181 G294S probably damaging Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Idh2 A T 7: 80,098,177 Y258* probably null Het
Immp2l T C 12: 41,110,934 V77A probably damaging Het
Isl1 T C 13: 116,305,388 E103G Het
Itgad A T 7: 128,203,850 T1059S probably damaging Het
Kcnj6 G A 16: 94,832,448 T268I probably damaging Het
Lgals3bp A G 11: 118,393,211 V514A probably benign Het
Mcfd2 A T 17: 87,257,993 H27Q probably benign Het
Mettl13 A G 1: 162,537,200 W537R probably damaging Het
Mybl2 G T 2: 163,064,305 G102V probably damaging Het
Nars2 C T 7: 97,039,918 T349M probably damaging Het
Nat8f3 A T 6: 85,761,726 V18E Het
Npepps T C 11: 97,258,351 E115G probably benign Het
Olfr1057 A G 2: 86,374,668 V248A probably damaging Het
Olfr1382 T A 11: 49,535,244 W20R probably damaging Het
Olfr834 A T 9: 18,988,230 M81L possibly damaging Het
Olfr926 G A 9: 38,877,985 V270M probably damaging Het
Oog2 T A 4: 144,196,137 V324E probably damaging Het
Pdzd2 A G 15: 12,375,400 S1550P probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pms2 T C 5: 143,917,602 V243A probably benign Het
Ptpn9 A G 9: 57,036,721 D293G probably benign Het
Ptprb A G 10: 116,367,536 K1784R probably damaging Het
Rab23 CAA CA 1: 33,724,996 probably null Het
Raf1 T C 6: 115,619,636 N576D probably benign Het
Rasa4 C A 5: 136,111,489 H782Q possibly damaging Het
Rims1 C A 1: 22,421,745 E168* probably null Het
Rpgrip1l A T 8: 91,260,806 N874K possibly damaging Het
Rxfp4 C T 3: 88,652,662 V161I possibly damaging Het
Scel G A 14: 103,605,596 G558D probably damaging Het
Sipa1l2 T C 8: 125,469,826 K723R probably null Het
Slc12a1 A T 2: 125,160,525 R142W probably damaging Het
Slc27a2 T A 2: 126,567,816 V306D probably damaging Het
Sox4 C T 13: 28,952,096 G309D probably damaging Het
Terb1 T C 8: 104,496,844 T111A probably benign Het
Tgfa G A 6: 86,271,415 R133H probably damaging Het
Ticrr T C 7: 79,696,006 S1836P probably damaging Het
Tlk2 A G 11: 105,247,502 D292G probably benign Het
Tmc7 A G 7: 118,541,937 I657T probably benign Het
Tmprss11c G A 5: 86,235,520 T349I probably benign Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Tsc22d1 T G 14: 76,416,543 I154S probably damaging Het
Vmn1r2 T C 4: 3,172,587 Y169H probably damaging Het
Vmn1r77 G T 7: 12,041,839 V181L probably benign Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
R8921:Atp13a4 UTSW 16 29454774 missense
R8940:Atp13a4 UTSW 16 29454690 critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29471888 critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29449979 missense
R9292:Atp13a4 UTSW 16 29422682 missense
R9415:Atp13a4 UTSW 16 29409003 missense
R9453:Atp13a4 UTSW 16 29420841 missense unknown
R9497:Atp13a4 UTSW 16 29469312 critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29422726 missense
R9622:Atp13a4 UTSW 16 29420459 missense
R9727:Atp13a4 UTSW 16 29409771 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- GTGGGAATTAACTGCCAGCC -3'
(R):5'- AGGCCTGTCAATATGCTGAG -3'

Sequencing Primer
(F):5'- GTCCCTGTTTTACCAGATGCAGAAG -3'
(R):5'- CCTGTCAATATGCTGAGGTGGTTG -3'
Posted On 2022-09-12