Incidental Mutation 'R7739:Atp13a4'
ID596454
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene NameATPase type 13A4
Synonyms9330174J19Rik, 4631413J11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7739 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location29395853-29544864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29456601 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 355 (I355T)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
Predicted Effect probably benign
Transcript: ENSMUST00000039090
AA Change: I355T

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: I355T

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: I355T

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182573
Predicted Effect possibly damaging
Transcript: ENSMUST00000182627
AA Change: I355T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: I355T

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T A 1: 177,743,262 I54K probably damaging Het
9130401M01Rik C A 15: 58,022,479 A336S probably benign Het
Abca8b A G 11: 109,974,591 S347P probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Atp2a2 G A 5: 122,469,705 T247I probably damaging Het
Atp2b1 T A 10: 99,001,365 D555E probably benign Het
Aurkb G T 11: 69,048,232 G94* probably null Het
B130006D01Rik A T 11: 95,726,160 H37L unknown Het
Cabin1 A G 10: 75,658,658 L1629P probably damaging Het
Ccdc80 A C 16: 45,095,823 D314A probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Chd9 T C 8: 91,035,025 L2246P probably damaging Het
Cpsf1 T A 15: 76,600,311 M657L probably benign Het
Dmtf1 A G 5: 9,140,453 V87A probably damaging Het
Drd5 G T 5: 38,320,078 W138L probably damaging Het
Dspp G A 5: 104,178,146 D792N unknown Het
Fat2 C A 11: 55,281,131 E2919* probably null Het
Fgf20 A G 8: 40,279,896 V167A probably damaging Het
Gm597 T A 1: 28,777,608 T448S possibly damaging Het
Gm8251 G A 1: 44,056,418 T1840I possibly damaging Het
Grm5 T C 7: 88,130,058 V934A possibly damaging Het
Gtf3c3 G T 1: 54,405,039 A730D possibly damaging Het
H2-T24 A G 17: 36,014,591 V335A probably benign Het
Havcr2 T G 11: 46,456,557 N120K probably damaging Het
Hmcn2 T C 2: 31,458,026 F4895L possibly damaging Het
Igsf3 T C 3: 101,435,531 Y475H probably damaging Het
Lonp1 T C 17: 56,626,620 D85G probably benign Het
Lrrc49 T C 9: 60,593,692 S657G probably benign Het
Lrrk2 T A 15: 91,700,613 Y382N probably damaging Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mtf1 T A 4: 124,824,288 C260S probably damaging Het
Naa35 A G 13: 59,599,784 D110G probably damaging Het
Npas3 A T 12: 54,068,718 T808S probably damaging Het
Olfr76 A G 19: 12,120,545 W56R probably damaging Het
Pax9 A T 12: 56,700,099 H240L probably benign Het
Pik3c2a T C 7: 116,394,294 T413A probably benign Het
Pik3r1 A G 13: 101,709,697 V127A probably benign Het
Pik3r5 A G 11: 68,490,498 E170G probably damaging Het
Polr1a T C 6: 71,954,835 I966T possibly damaging Het
Prelid2 A G 18: 41,912,368 probably null Het
Rab29 T A 1: 131,872,185 M166K probably damaging Het
Rab2b T C 14: 52,266,260 E135G probably damaging Het
Rnf103 T A 6: 71,509,479 S365T possibly damaging Het
Rnf213 G A 11: 119,410,861 E387K Het
Sh3d19 T C 3: 86,123,731 V734A probably benign Het
Ssbp1 T G 6: 40,477,980 N124K probably damaging Het
Tbc1d31 C T 15: 57,936,098 R227* probably null Het
Tcerg1 A G 18: 42,523,974 T174A unknown Het
Tenm2 T C 11: 36,069,561 S980G possibly damaging Het
Trim30a T C 7: 104,430,179 I156M possibly damaging Het
Trim39 T C 17: 36,260,504 D454G possibly damaging Het
Trpc7 A T 13: 56,773,766 *863K probably null Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Vmn1r33 C T 6: 66,612,373 D66N probably benign Het
Vmn2r8 A T 5: 108,802,177 I268N probably damaging Het
Vmn2r91 A C 17: 18,135,818 E582D probably benign Het
Vtcn1 T C 3: 100,883,895 F83S probably damaging Het
Wdr81 G T 11: 75,441,985 D684E Het
Wipi1 A G 11: 109,579,709 S295P probably damaging Het
Zfp27 A T 7: 29,894,274 H755Q possibly damaging Het
Zfp963 A G 8: 69,742,883 F307L possibly damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- ATTTACTGAGATGCACAGGCCAC -3'
(R):5'- TTTGCACAGGAAAGGCACTC -3'

Sequencing Primer
(F):5'- GGCCACCGTCAATCAGC -3'
(R):5'- TCCACCCCACAAAGTAAGATTG -3'
Posted On2019-11-26