Incidental Mutation 'R6497:Atp13a4'
ID523082
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene NameATPase type 13A4
Synonyms9330174J19Rik, 4631413J11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6497 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location29395853-29544864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29479901 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000138479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
Predicted Effect probably damaging
Transcript: ENSMUST00000039090
AA Change: D80G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: D80G

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057018
AA Change: D80G

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: D80G

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182627
AA Change: D80G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: D80G

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7980:Atp13a4 UTSW 16 29396466 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- AACATCACTGCAAGACTGGC -3'
(R):5'- GAGCTAGTGTCTCACGTTTCTG -3'

Sequencing Primer
(F):5'- TCTATGGGCACACATATGGC -3'
(R):5'- TGTCCACAGTCCTTAATAAATGACC -3'
Posted On2018-06-06