Incidental Mutation 'R9260:Hikeshi'
ID 726266
Institutional Source Beutler Lab
Gene Symbol Hikeshi
Ensembl Gene ENSMUSG00000062797
Gene Name heat shock protein nuclear import factor
Synonyms 0610007P06Rik, Hikeshi, l(7)6Rn, 1110002N09Rik, l7Rn6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 89917529-89941204 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 89930568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075010] [ENSMUST00000078918] [ENSMUST00000130609] [ENSMUST00000153470] [ENSMUST00000207309]
AlphaFold Q9DD02
Predicted Effect probably benign
Transcript: ENSMUST00000075010
SMART Domains Protein: ENSMUSP00000102856
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 1 156 5.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078918
SMART Domains Protein: ENSMUSP00000077951
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 1 89 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130609
Predicted Effect probably benign
Transcript: ENSMUST00000153470
SMART Domains Protein: ENSMUSP00000119806
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 1 195 2.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207309
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved nuclear transport receptor that mediates heat-shock-induced nuclear import of 70 kDa heat-shock proteins (Hsp70s) through interactions with FG-nucleoporins. The protein mediates transport of the ATP form but not the ADP form of Hsp70 proteins under conditions of heat shock stress. Structural analyses demonstrate that the protein forms an asymmetric homodimer and that the N-terminal domain consists of a jelly-roll/beta-sandwich fold structure that contains hydrophobic pockets involved in FG-nucleoporin recognition. Reduction of RNA expression levels in HeLa cells using small interfering RNAs results in inhibition of heat shock-induced nuclear accumulation of Hsp70s, indicating a role for this gene in regulation of Hsp70 nuclear import during heat shock stress. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation die prenatally or neonatally, and exhibit cyanoisis with a significant emphysematous phenotype at birth. The secretory apparatus in Clara cells is also affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Hikeshi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Hikeshi APN 7 89935781 missense probably damaging 0.99
IGL00502:Hikeshi APN 7 89923610 missense probably benign 0.34
IGL02296:Hikeshi APN 7 89935922 missense probably damaging 1.00
IGL02749:Hikeshi APN 7 89935889 missense possibly damaging 0.47
IGL03110:Hikeshi APN 7 89935826 missense probably damaging 1.00
R0023:Hikeshi UTSW 7 89920204 splice site probably benign
R0591:Hikeshi UTSW 7 89920087 missense possibly damaging 0.74
R1119:Hikeshi UTSW 7 89935730 missense probably benign 0.04
R4646:Hikeshi UTSW 7 89923646 missense probably damaging 1.00
R6799:Hikeshi UTSW 7 89930345 intron probably benign
R7694:Hikeshi UTSW 7 89930346 nonsense probably null
R7698:Hikeshi UTSW 7 89923681 missense probably benign 0.05
R9294:Hikeshi UTSW 7 89935760 missense probably damaging 1.00
R9730:Hikeshi UTSW 7 89920163 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCACTGGAATGCAATGCTCCC -3'
(R):5'- TCTGTTAAAATCTGTAGCAGCTGTG -3'

Sequencing Primer
(F):5'- GAATGCAATGCTCCCTGACTGAG -3'
(R):5'- AATCTGTAGCAGCTGTGAGTAATG -3'
Posted On 2022-09-14