Incidental Mutation 'R0848:Exoc7'
ID77445
Institutional Source Beutler Lab
Gene Symbol Exoc7
Ensembl Gene ENSMUSG00000020792
Gene Nameexocyst complex component 7
Synonymssec70, Exo70, 70kDa
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116288001-116307233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116295248 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 376 (S376P)
Ref Sequence ENSEMBL: ENSMUSP00000021147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000106411] [ENSMUST00000106413] [ENSMUST00000126731]
PDB Structure
The Crystal Structure of Mouse Exo70 Reveals Unique Features of the Mammalian Exocyst [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021147
AA Change: S376P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792
AA Change: S376P

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106411
AA Change: S345P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792
AA Change: S345P

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106413
AA Change: S376P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792
AA Change: S376P

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126731
SMART Domains Protein: ENSMUSP00000121794
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
PDB:2PFT|A 78 265 1e-113 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155288
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex. The exocyst complex plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. The encoded protein is required for assembly of the exocyst complex and docking of the complex to the plasma membrane. The encoded protein may also play a role in pre-mRNA splicing through interactions with pre-mRNA-processing factor 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Exoc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Exoc7 APN 11 116301100 splice site probably null
IGL02825:Exoc7 APN 11 116297585 missense probably damaging 0.98
IGL03068:Exoc7 APN 11 116301134 missense possibly damaging 0.70
IGL03333:Exoc7 APN 11 116301161 missense probably benign 0.17
IGL03412:Exoc7 APN 11 116289275 missense possibly damaging 0.57
IGL02799:Exoc7 UTSW 11 116301181 missense probably damaging 1.00
R0022:Exoc7 UTSW 11 116297582 missense possibly damaging 0.62
R0068:Exoc7 UTSW 11 116304906 missense probably damaging 1.00
R0158:Exoc7 UTSW 11 116295292 missense probably benign 0.01
R0362:Exoc7 UTSW 11 116295662 missense probably benign 0.37
R0387:Exoc7 UTSW 11 116294401 unclassified probably benign
R0394:Exoc7 UTSW 11 116300398 missense probably damaging 0.99
R0714:Exoc7 UTSW 11 116293294 missense probably benign 0.16
R1611:Exoc7 UTSW 11 116295265 missense possibly damaging 0.84
R1795:Exoc7 UTSW 11 116292521 missense probably damaging 0.98
R2259:Exoc7 UTSW 11 116306411 missense probably damaging 1.00
R3911:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3913:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3979:Exoc7 UTSW 11 116296762 missense probably benign 0.30
R4029:Exoc7 UTSW 11 116306988 unclassified probably benign
R4576:Exoc7 UTSW 11 116289183 makesense probably null
R4983:Exoc7 UTSW 11 116289269 missense probably damaging 1.00
R5309:Exoc7 UTSW 11 116305027 nonsense probably null
R6453:Exoc7 UTSW 11 116293969 splice site probably null
R7275:Exoc7 UTSW 11 116304862 critical splice donor site probably null
R7585:Exoc7 UTSW 11 116300298 missense probably benign 0.00
R7609:Exoc7 UTSW 11 116289259 missense possibly damaging 0.63
R7774:Exoc7 UTSW 11 116295316 missense possibly damaging 0.80
R8007:Exoc7 UTSW 11 116306639 missense possibly damaging 0.93
X0063:Exoc7 UTSW 11 116304949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATCTTGACTTGTCCAAAGCCC -3'
(R):5'- CACTGCCCCATGTAGCTGTTACTG -3'

Sequencing Primer
(F):5'- TCCCAGAAGGGAGtaaagggac -3'
(R):5'- AGCCTGTTGTCGCCCTAAG -3'
Posted On2013-10-16