Incidental Mutation 'R0848:Cdkl3'
ID 77438
Institutional Source Beutler Lab
Gene Symbol Cdkl3
Ensembl Gene ENSMUSG00000020389
Gene Name cyclin dependent kinase like 3
Synonyms B230379H01Rik
MMRRC Submission 039027-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.823) question?
Stock # R0848 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 51895048-51980611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 51902094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 101 (R101Q)
Ref Sequence ENSEMBL: ENSMUSP00000112477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063303] [ENSMUST00000063321] [ENSMUST00000109076] [ENSMUST00000109077] [ENSMUST00000109078] [ENSMUST00000109079] [ENSMUST00000109080] [ENSMUST00000120374] [ENSMUST00000135076] [ENSMUST00000143228] [ENSMUST00000121591] [ENSMUST00000109081]
AlphaFold Q8BLF2
Predicted Effect probably damaging
Transcript: ENSMUST00000063303
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000063321
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109076
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109077
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109078
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109079
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109080
AA Change: R101Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120374
AA Change: R101Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000135076
AA Change: R101Q

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117983
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
Pfam:Pkinase 4 192 5.6e-65 PFAM
Pfam:Pkinase_Tyr 4 192 7.3e-37 PFAM
Pfam:Kinase-like 49 192 3.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143228
AA Change: R101Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123279
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121591
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109081
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,984 (GRCm39) H181Q probably damaging Het
Abca13 T A 11: 9,632,011 (GRCm39) L4977* probably null Het
Abca8a T A 11: 109,919,016 (GRCm39) Y1550F probably damaging Het
Actr2 C T 11: 20,022,584 (GRCm39) E296K probably benign Het
Agtpbp1 A T 13: 59,681,753 (GRCm39) probably benign Het
Anks1b A C 10: 89,906,987 (GRCm39) E268A probably damaging Het
C1rl A G 6: 124,485,465 (GRCm39) T279A probably benign Het
C5ar2 T C 7: 15,971,526 (GRCm39) T134A probably benign Het
Celsr2 A T 3: 108,321,654 (GRCm39) F386Y probably benign Het
Chd1 C T 17: 15,990,503 (GRCm39) P1685L probably damaging Het
Chrne G T 11: 70,506,239 (GRCm39) H402Q probably benign Het
Clvs1 A G 4: 9,282,003 (GRCm39) D149G possibly damaging Het
Cntnap5b T C 1: 100,182,888 (GRCm39) Y620H probably benign Het
Col6a1 A G 10: 76,549,458 (GRCm39) probably null Het
Cyp2d26 T A 15: 82,674,434 (GRCm39) I483F probably benign Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dmac2l A T 12: 69,788,584 (GRCm39) H161L probably benign Het
Eif1a T A 18: 46,741,114 (GRCm39) N116K possibly damaging Het
Epb41l5 A T 1: 119,477,684 (GRCm39) C696S probably benign Het
Exoc7 A G 11: 116,186,074 (GRCm39) S376P possibly damaging Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gimap7 T C 6: 48,700,657 (GRCm39) I81T probably damaging Het
Gtf2a1l T C 17: 89,001,657 (GRCm39) V171A probably damaging Het
Hax1 A G 3: 89,902,940 (GRCm39) S253P probably damaging Het
Hsd3b5 A T 3: 98,526,671 (GRCm39) D258E probably damaging Het
Kcnb1 G T 2: 166,948,187 (GRCm39) F220L probably damaging Het
Kif1a T A 1: 92,947,620 (GRCm39) Y1708F probably damaging Het
Krt14 A T 11: 100,095,090 (GRCm39) I379N probably damaging Het
Lpxn A G 19: 12,781,401 (GRCm39) I40V probably benign Het
Lrp1 C T 10: 127,389,231 (GRCm39) probably null Het
Lyst G A 13: 13,809,515 (GRCm39) R395H probably benign Het
Mindy4 G A 6: 55,295,271 (GRCm39) W737* probably null Het
Mki67 C A 7: 135,302,772 (GRCm39) R754L probably benign Het
Morf4l1 A G 9: 89,982,502 (GRCm39) V144A probably benign Het
Mvb12a T C 8: 71,998,422 (GRCm39) S186P probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Nipal1 A G 5: 72,825,183 (GRCm39) N292S probably damaging Het
Nqo2 T G 13: 34,156,461 (GRCm39) probably null Het
Or14a256 T C 7: 86,264,848 (GRCm39) Y335C probably damaging Het
Or2d3b A G 7: 106,514,200 (GRCm39) K265R probably benign Het
Or5ak24 A T 2: 85,260,365 (GRCm39) N269K probably benign Het
Or6c214 C T 10: 129,591,077 (GRCm39) V81I probably benign Het
Osbpl7 C A 11: 96,951,350 (GRCm39) P507Q probably damaging Het
Pcdhb1 G A 18: 37,400,475 (GRCm39) G809S probably benign Het
Pcm1 T C 8: 41,735,720 (GRCm39) V846A probably damaging Het
Phf3 A G 1: 30,902,253 (GRCm39) L20P probably damaging Het
Pih1d1 A G 7: 44,807,041 (GRCm39) T58A probably damaging Het
Plekhn1 A G 4: 156,308,021 (GRCm39) probably null Het
Plvap A T 8: 71,959,526 (GRCm39) L422Q probably damaging Het
Polq C T 16: 36,882,492 (GRCm39) A1273V probably benign Het
Prelid2 T A 18: 42,068,289 (GRCm39) I51F probably damaging Het
Ptpn18 G A 1: 34,501,783 (GRCm39) D8N probably damaging Het
Ptpra T A 2: 130,360,911 (GRCm39) F190Y probably damaging Het
Pus7l A G 15: 94,438,393 (GRCm39) S151P probably benign Het
Rsph6a G A 7: 18,791,595 (GRCm39) D255N probably benign Het
Serpinb6c A T 13: 34,083,288 (GRCm39) V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 (GRCm39) N22S probably benign Het
Snx5 G A 2: 144,095,726 (GRCm39) R312C probably damaging Het
Stard9 T C 2: 120,526,304 (GRCm39) S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,144,733 (GRCm39) probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,144,734 (GRCm39) probably null Het
Tlr12 A G 4: 128,510,084 (GRCm39) I722T probably benign Het
Tmem101 A T 11: 102,046,692 (GRCm39) M59K possibly damaging Het
Trim34a C T 7: 103,910,331 (GRCm39) R378C probably benign Het
Trim35 T A 14: 66,546,574 (GRCm39) M447K probably benign Het
Trps1 C A 15: 50,524,945 (GRCm39) S704I possibly damaging Het
Vmn1r231 T A 17: 21,110,433 (GRCm39) S161C probably damaging Het
Vps13a A C 19: 16,676,261 (GRCm39) N1237K probably damaging Het
Zfp619 G T 7: 39,185,983 (GRCm39) C671F probably damaging Het
Other mutations in Cdkl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdkl3 APN 11 51,920,683 (GRCm39) missense probably benign 0.28
IGL01632:Cdkl3 APN 11 51,895,899 (GRCm39) missense probably damaging 1.00
IGL01768:Cdkl3 APN 11 51,916,744 (GRCm39) missense probably damaging 1.00
IGL01974:Cdkl3 APN 11 51,902,064 (GRCm39) missense probably damaging 1.00
IGL01981:Cdkl3 APN 11 51,895,896 (GRCm39) missense probably benign 0.43
IGL02510:Cdkl3 APN 11 51,902,097 (GRCm39) missense probably damaging 1.00
R0027:Cdkl3 UTSW 11 51,923,176 (GRCm39) unclassified probably benign
R0027:Cdkl3 UTSW 11 51,923,176 (GRCm39) unclassified probably benign
R0480:Cdkl3 UTSW 11 51,895,882 (GRCm39) missense probably damaging 1.00
R0499:Cdkl3 UTSW 11 51,923,243 (GRCm39) missense possibly damaging 0.52
R0627:Cdkl3 UTSW 11 51,902,135 (GRCm39) missense probably damaging 1.00
R1510:Cdkl3 UTSW 11 51,924,341 (GRCm39) missense possibly damaging 0.90
R1558:Cdkl3 UTSW 11 51,923,337 (GRCm39) missense possibly damaging 0.62
R2046:Cdkl3 UTSW 11 51,917,677 (GRCm39) missense probably benign
R2077:Cdkl3 UTSW 11 51,917,666 (GRCm39) missense probably damaging 0.98
R2207:Cdkl3 UTSW 11 51,918,020 (GRCm39) makesense probably null
R2271:Cdkl3 UTSW 11 51,923,322 (GRCm39) missense probably benign 0.07
R2272:Cdkl3 UTSW 11 51,923,322 (GRCm39) missense probably benign 0.07
R4032:Cdkl3 UTSW 11 51,902,118 (GRCm39) missense probably damaging 1.00
R4839:Cdkl3 UTSW 11 51,895,861 (GRCm39) missense probably damaging 1.00
R4971:Cdkl3 UTSW 11 51,901,995 (GRCm39) missense possibly damaging 0.48
R6541:Cdkl3 UTSW 11 51,913,571 (GRCm39) missense probably damaging 1.00
R6559:Cdkl3 UTSW 11 51,916,696 (GRCm39) missense probably benign 0.04
R7034:Cdkl3 UTSW 11 51,918,042 (GRCm39) missense probably benign 0.00
R7068:Cdkl3 UTSW 11 51,902,154 (GRCm39) critical splice donor site probably null
R7406:Cdkl3 UTSW 11 51,924,369 (GRCm39) missense probably benign 0.11
R7658:Cdkl3 UTSW 11 51,918,009 (GRCm39) missense not run
R7870:Cdkl3 UTSW 11 51,909,284 (GRCm39) critical splice donor site probably null
R8324:Cdkl3 UTSW 11 51,913,706 (GRCm39) critical splice donor site probably null
R8331:Cdkl3 UTSW 11 51,917,704 (GRCm39) missense probably benign 0.04
R8349:Cdkl3 UTSW 11 51,975,260 (GRCm39) missense
R8449:Cdkl3 UTSW 11 51,975,260 (GRCm39) missense
R8806:Cdkl3 UTSW 11 51,923,295 (GRCm39) missense possibly damaging 0.66
R9262:Cdkl3 UTSW 11 51,916,702 (GRCm39) missense probably benign 0.21
R9360:Cdkl3 UTSW 11 51,924,349 (GRCm39) missense probably null 0.00
R9385:Cdkl3 UTSW 11 51,926,779 (GRCm39) missense probably benign 0.01
R9623:Cdkl3 UTSW 11 51,895,816 (GRCm39) missense probably damaging 1.00
R9729:Cdkl3 UTSW 11 51,895,770 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGCCAAGCCAGTTGAGAGCTTC -3'
(R):5'- TGCAGCCATGATGCTCCAAGAG -3'

Sequencing Primer
(F):5'- CCAGTTGAGAGCTTCTGTTGAAAG -3'
(R):5'- CATGATGCTCCAAGAGAATTATGG -3'
Posted On 2013-10-16