Incidental Mutation 'R0848:Cdkl3'
ID77438
Institutional Source Beutler Lab
Gene Symbol Cdkl3
Ensembl Gene ENSMUSG00000020389
Gene Namecyclin-dependent kinase-like 3
SynonymsB230379H01Rik
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location52004221-52089784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52011267 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 101 (R101Q)
Ref Sequence ENSEMBL: ENSMUSP00000112477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063303] [ENSMUST00000063321] [ENSMUST00000109076] [ENSMUST00000109077] [ENSMUST00000109078] [ENSMUST00000109079] [ENSMUST00000109080] [ENSMUST00000109081] [ENSMUST00000120374] [ENSMUST00000121591] [ENSMUST00000135076] [ENSMUST00000143228]
Predicted Effect probably damaging
Transcript: ENSMUST00000063303
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000063321
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109076
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109077
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109078
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109079
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109080
AA Change: R101Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109081
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120374
AA Change: R101Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121591
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000135076
AA Change: R101Q

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117983
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
Pfam:Pkinase 4 192 5.6e-65 PFAM
Pfam:Pkinase_Tyr 4 192 7.3e-37 PFAM
Pfam:Kinase-like 49 192 3.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143228
AA Change: R101Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123279
Gene: ENSMUSG00000020389
AA Change: R101Q

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Cdkl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdkl3 APN 11 52029856 missense probably benign 0.28
IGL01632:Cdkl3 APN 11 52005072 missense probably damaging 1.00
IGL01768:Cdkl3 APN 11 52025917 missense probably damaging 1.00
IGL01974:Cdkl3 APN 11 52011237 missense probably damaging 1.00
IGL01981:Cdkl3 APN 11 52005069 missense probably benign 0.43
IGL02510:Cdkl3 APN 11 52011270 missense probably damaging 1.00
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0480:Cdkl3 UTSW 11 52005055 missense probably damaging 1.00
R0499:Cdkl3 UTSW 11 52032416 missense possibly damaging 0.52
R0627:Cdkl3 UTSW 11 52011308 missense probably damaging 1.00
R1510:Cdkl3 UTSW 11 52033514 missense possibly damaging 0.90
R1558:Cdkl3 UTSW 11 52032510 missense possibly damaging 0.62
R2046:Cdkl3 UTSW 11 52026850 missense probably benign
R2077:Cdkl3 UTSW 11 52026839 missense probably damaging 0.98
R2207:Cdkl3 UTSW 11 52027193 makesense probably null
R2271:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R2272:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R4032:Cdkl3 UTSW 11 52011291 missense probably damaging 1.00
R4839:Cdkl3 UTSW 11 52005034 missense probably damaging 1.00
R4971:Cdkl3 UTSW 11 52011168 missense possibly damaging 0.48
R6541:Cdkl3 UTSW 11 52022744 missense probably damaging 1.00
R6559:Cdkl3 UTSW 11 52025869 missense probably benign 0.04
R7034:Cdkl3 UTSW 11 52027215 missense probably benign 0.00
R7068:Cdkl3 UTSW 11 52011327 critical splice donor site probably null
R7406:Cdkl3 UTSW 11 52033542 missense probably benign 0.11
R7658:Cdkl3 UTSW 11 52027182 missense not run
R7870:Cdkl3 UTSW 11 52018457 critical splice donor site probably null
R8324:Cdkl3 UTSW 11 52022879 critical splice donor site probably null
R8331:Cdkl3 UTSW 11 52026877 missense probably benign 0.04
R8349:Cdkl3 UTSW 11 52084433 missense
R8449:Cdkl3 UTSW 11 52084433 missense
R8806:Cdkl3 UTSW 11 52032468 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGCCAAGCCAGTTGAGAGCTTC -3'
(R):5'- TGCAGCCATGATGCTCCAAGAG -3'

Sequencing Primer
(F):5'- CCAGTTGAGAGCTTCTGTTGAAAG -3'
(R):5'- CATGATGCTCCAAGAGAATTATGG -3'
Posted On2013-10-16