Mutagenetix > Incidental Mutations

Incidental Mutation 'R0928:Vwa5a'

80658

Institutional Source

Beutler Lab

Gene Symbol

Vwa5a

Ensembl Gene

ENSMUSG00000023186

Gene Name

von Willebrand factor A domain containing 5A

Synonyms

Loh11cr2a, 5830475I06Rik, BCSC-1

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0928 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38718268-38743337 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38728007 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 345 (Y345H)

Ref Sequence

ENSEMBL: ENSMUSP00000113596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001544] [ENSMUST00000118144]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001544
AA Change: Y345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001544
Gene: ENSMUSG00000023186
AA Change: Y345H

Domain	Start	End	E-Value	Type
VIT	1	131	2.59e-61	SMART
VWA	279	460	2.61e-12	SMART
low complexity region	615	629	N/A	INTRINSIC
low complexity region	664	678	N/A	INTRINSIC
Blast:VWA	681	713	2e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000118144
AA Change: Y345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113596
Gene: ENSMUSG00000023186
AA Change: Y345H

Domain	Start	End	E-Value	Type
VIT	1	131	2.59e-61	SMART
VWA	279	460	2.61e-12	SMART
low complexity region	615	629	N/A	INTRINSIC
low complexity region	664	678	N/A	INTRINSIC
Blast:VWA	681	713	2e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149376

Coding Region Coverage

1x: 99.2%
3x: 98.1%
10x: 93.0%
20x: 75.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,624,582	D745G	possibly damaging	Het
4931406P16Rik	A	T	7: 34,248,246		probably null	Het
Abca12	T	A	1: 71,349,174	D179V	probably benign	Het
Abcc1	T	C	16: 14,389,985		probably null	Het
Adad1	G	A	3: 37,076,740		probably null	Het
Apobec4	T	C	1: 152,756,277	Y19H	probably damaging	Het
Bco2	T	A	9: 50,545,931	T104S	probably damaging	Het
Bnc1	A	G	7: 81,973,502	V659A	probably benign	Het
Ccdc144b	A	C	3: 36,025,366	N258K	possibly damaging	Het
Ccs	T	C	19: 4,825,960	E184G	probably damaging	Het
Cfap70	T	G	14: 20,443,919	K97N	probably damaging	Het
Daam2	T	C	17: 49,488,227	I313V	probably benign	Het
Dach1	T	C	14: 97,915,832	S467G	probably damaging	Het
Dnah11	A	G	12: 118,045,562	S2122P	probably damaging	Het
Dnah3	T	A	7: 120,030,051	D1427V	probably damaging	Het
Dnaic1	T	C	4: 41,602,566	F97L	possibly damaging	Het
Dsc1	A	T	18: 20,110,249		probably null	Het
En2	A	T	5: 28,170,331	K291*	probably null	Het
Eps15	T	C	4: 109,312,963	V154A	possibly damaging	Het
Etnk1	A	G	6: 143,184,703	I183V	probably benign	Het
Fcrlb	A	T	1: 170,907,940	V255D	possibly damaging	Het
Fry	A	T	5: 150,437,084	E52V	probably damaging	Het
Gm8251	C	A	1: 44,057,228	S1570I	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,885	Y152C	probably damaging	Het
Hao1	C	A	2: 134,505,616	L256F	possibly damaging	Het
Helz	T	A	11: 107,626,693	I685K	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Izumo2	A	T	7: 44,715,423	I171F	possibly damaging	Het
Krt83	C	A	15: 101,491,280	C57F	probably benign	Het
Mapkbp1	A	G	2: 120,015,368	H400R	probably benign	Het
Megf6	T	A	4: 154,177,047	V43E	probably damaging	Het
Mut	T	C	17: 40,937,283	I67T	probably benign	Het
Ninl	A	T	2: 150,963,475	V396E	probably damaging	Het
Nvl	A	T	1: 181,093,902	V844E	probably benign	Het
Olfr11	C	T	13: 21,638,956	C189Y	probably damaging	Het
P2rx3	A	T	2: 85,035,298	M1K	probably null	Het
Pabpn1l	T	C	8: 122,622,619	T20A	probably benign	Het
Ppp3r2	C	A	4: 49,681,439		probably null	Het
Prmt6	C	T	3: 110,250,682	G97D	probably damaging	Het
Prmt9	T	C	8: 77,581,176	V823A	probably damaging	Het
Skint11	C	A	4: 114,244,601	D79E	possibly damaging	Het
Slc17a8	T	A	10: 89,598,683	H194L	probably damaging	Het
Slco6c1	T	A	1: 97,104,848	I293F	possibly damaging	Het
Tcl1b4	A	T	12: 105,202,606	H43L	probably benign	Het
Tm9sf1	T	C	14: 55,636,457	D528G	probably damaging	Het
Tpbpb	C	T	13: 60,902,175	V47I	probably benign	Het
Ttc37	T	G	13: 76,113,592	L142W	probably damaging	Het
Ttn	G	T	2: 76,907,532		probably benign	Het
Usp28	T	G	9: 49,030,891	S341A	possibly damaging	Het
Wdr11	C	A	7: 129,606,653	D377E	probably damaging	Het
Zer1	A	G	2: 30,101,763		probably null	Het

Other mutations in Vwa5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Vwa5a	APN	9	38737814	splice site	probably null
IGL00966:Vwa5a	APN	9	38723379	missense	probably benign	0.24
IGL01597:Vwa5a	APN	9	38733865	missense	probably damaging	1.00
IGL01950:Vwa5a	APN	9	38726970	missense	probably damaging	1.00
IGL02008:Vwa5a	APN	9	38737776	missense	probably benign	0.08
IGL02326:Vwa5a	APN	9	38737956	missense	probably benign
IGL02378:Vwa5a	APN	9	38733970	missense	probably benign	0.41
IGL02442:Vwa5a	APN	9	38734784	missense	probably benign	0.02
IGL02458:Vwa5a	APN	9	38726963	missense	possibly damaging	0.79
IGL02570:Vwa5a	APN	9	38734871	unclassified	probably benign
IGL03068:Vwa5a	APN	9	38734847	missense	probably benign	0.45
R0126:Vwa5a	UTSW	9	38737807	splice site	probably null
R0325:Vwa5a	UTSW	9	38728665	missense	probably damaging	1.00
R0617:Vwa5a	UTSW	9	38723895	missense	probably damaging	1.00
R1334:Vwa5a	UTSW	9	38734741	missense	probably benign	0.01
R1446:Vwa5a	UTSW	9	38733968	missense	possibly damaging	0.95
R1708:Vwa5a	UTSW	9	38727832	missense	probably benign
R1986:Vwa5a	UTSW	9	38737814	splice site	probably benign
R2024:Vwa5a	UTSW	9	38736061	missense	probably damaging	0.98
R2230:Vwa5a	UTSW	9	38733878	missense	probably null	1.00
R2252:Vwa5a	UTSW	9	38728080	missense	probably damaging	1.00
R2278:Vwa5a	UTSW	9	38723207	missense	probably damaging	1.00
R3912:Vwa5a	UTSW	9	38734743	missense	probably damaging	0.97
R3913:Vwa5a	UTSW	9	38734743	missense	probably damaging	0.97
R4172:Vwa5a	UTSW	9	38723870	missense	probably damaging	0.98
R4244:Vwa5a	UTSW	9	38737816	splice site	probably benign
R4510:Vwa5a	UTSW	9	38722557	missense	possibly damaging	0.60
R4511:Vwa5a	UTSW	9	38722557	missense	possibly damaging	0.60
R4549:Vwa5a	UTSW	9	38737925	missense	probably benign	0.09
R4591:Vwa5a	UTSW	9	38735620	missense	possibly damaging	0.94
R4639:Vwa5a	UTSW	9	38727114	critical splice donor site	probably null
R4811:Vwa5a	UTSW	9	38735953	missense	probably benign	0.00
R4911:Vwa5a	UTSW	9	38737972	missense	probably benign	0.03
R4936:Vwa5a	UTSW	9	38736198	missense	probably benign	0.00
R4989:Vwa5a	UTSW	9	38722630	missense	probably benign	0.40
R5370:Vwa5a	UTSW	9	38741216	missense	probably benign	0.02
R5596:Vwa5a	UTSW	9	38722578	missense	probably damaging	1.00
R5914:Vwa5a	UTSW	9	38741742	missense	probably benign	0.00
R6207:Vwa5a	UTSW	9	38722672	missense	probably damaging	1.00
R6486:Vwa5a	UTSW	9	38733878	missense	probably null	1.00
R7666:Vwa5a	UTSW	9	38733963	missense	probably benign	0.06
R7683:Vwa5a	UTSW	9	38734829	missense	probably damaging	1.00
R7763:Vwa5a	UTSW	9	38741162	missense	possibly damaging	0.93
R7839:Vwa5a	UTSW	9	38723503	missense	probably damaging	0.98
R7922:Vwa5a	UTSW	9	38723503	missense	probably damaging	0.98
R7996:Vwa5a	UTSW	9	38727828	nonsense	probably null
R8024:Vwa5a	UTSW	9	38736020	nonsense	probably null
X0022:Vwa5a	UTSW	9	38735962	missense	probably damaging	1.00
X0067:Vwa5a	UTSW	9	38723251	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGGACTCTGAACGGTTGTGC -3'
(R):5'- TCTACGCTGTCACAGAGACTCTCC -3'

Sequencing Primer
(F):5'- ACAATGTGCAGTGTGTGC -3'
(R):5'- CTGCTGACCACATGGAATAATG -3'

Posted On

2013-11-07