Incidental Mutation 'R0928:Vwa5a'
ID80658
Institutional Source Beutler Lab
Gene Symbol Vwa5a
Ensembl Gene ENSMUSG00000023186
Gene Namevon Willebrand factor A domain containing 5A
SynonymsLoh11cr2a, 5830475I06Rik, BCSC-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0928 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38718268-38743337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38728007 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 345 (Y345H)
Ref Sequence ENSEMBL: ENSMUSP00000113596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001544] [ENSMUST00000118144]
Predicted Effect probably damaging
Transcript: ENSMUST00000001544
AA Change: Y345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001544
Gene: ENSMUSG00000023186
AA Change: Y345H

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118144
AA Change: Y345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113596
Gene: ENSMUSG00000023186
AA Change: Y345H

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149376
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Vwa5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vwa5a APN 9 38737814 splice site probably null
IGL00966:Vwa5a APN 9 38723379 missense probably benign 0.24
IGL01597:Vwa5a APN 9 38733865 missense probably damaging 1.00
IGL01950:Vwa5a APN 9 38726970 missense probably damaging 1.00
IGL02008:Vwa5a APN 9 38737776 missense probably benign 0.08
IGL02326:Vwa5a APN 9 38737956 missense probably benign
IGL02378:Vwa5a APN 9 38733970 missense probably benign 0.41
IGL02442:Vwa5a APN 9 38734784 missense probably benign 0.02
IGL02458:Vwa5a APN 9 38726963 missense possibly damaging 0.79
IGL02570:Vwa5a APN 9 38734871 unclassified probably benign
IGL03068:Vwa5a APN 9 38734847 missense probably benign 0.45
R0126:Vwa5a UTSW 9 38737807 splice site probably null
R0325:Vwa5a UTSW 9 38728665 missense probably damaging 1.00
R0617:Vwa5a UTSW 9 38723895 missense probably damaging 1.00
R1334:Vwa5a UTSW 9 38734741 missense probably benign 0.01
R1446:Vwa5a UTSW 9 38733968 missense possibly damaging 0.95
R1708:Vwa5a UTSW 9 38727832 missense probably benign
R1986:Vwa5a UTSW 9 38737814 splice site probably benign
R2024:Vwa5a UTSW 9 38736061 missense probably damaging 0.98
R2230:Vwa5a UTSW 9 38733878 missense probably null 1.00
R2252:Vwa5a UTSW 9 38728080 missense probably damaging 1.00
R2278:Vwa5a UTSW 9 38723207 missense probably damaging 1.00
R3912:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R3913:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R4172:Vwa5a UTSW 9 38723870 missense probably damaging 0.98
R4244:Vwa5a UTSW 9 38737816 splice site probably benign
R4510:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4511:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4549:Vwa5a UTSW 9 38737925 missense probably benign 0.09
R4591:Vwa5a UTSW 9 38735620 missense possibly damaging 0.94
R4639:Vwa5a UTSW 9 38727114 critical splice donor site probably null
R4811:Vwa5a UTSW 9 38735953 missense probably benign 0.00
R4911:Vwa5a UTSW 9 38737972 missense probably benign 0.03
R4936:Vwa5a UTSW 9 38736198 missense probably benign 0.00
R4989:Vwa5a UTSW 9 38722630 missense probably benign 0.40
R5370:Vwa5a UTSW 9 38741216 missense probably benign 0.02
R5596:Vwa5a UTSW 9 38722578 missense probably damaging 1.00
R5914:Vwa5a UTSW 9 38741742 missense probably benign 0.00
R6207:Vwa5a UTSW 9 38722672 missense probably damaging 1.00
R6486:Vwa5a UTSW 9 38733878 missense probably null 1.00
R7666:Vwa5a UTSW 9 38733963 missense probably benign 0.06
R7683:Vwa5a UTSW 9 38734829 missense probably damaging 1.00
R7763:Vwa5a UTSW 9 38741162 missense possibly damaging 0.93
R7839:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7922:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7996:Vwa5a UTSW 9 38727828 nonsense probably null
R8024:Vwa5a UTSW 9 38736020 nonsense probably null
X0022:Vwa5a UTSW 9 38735962 missense probably damaging 1.00
X0067:Vwa5a UTSW 9 38723251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGGACTCTGAACGGTTGTGC -3'
(R):5'- TCTACGCTGTCACAGAGACTCTCC -3'

Sequencing Primer
(F):5'- ACAATGTGCAGTGTGTGC -3'
(R):5'- CTGCTGACCACATGGAATAATG -3'
Posted On2013-11-07