Incidental Mutation 'R0928:Slco6c1'
ID 80590
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Name solute carrier organic anion transporter family, member 6c1
Synonyms 4933404A18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0928 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 97059038-97128301 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 97104848 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 293 (I293F)
Ref Sequence ENSEMBL: ENSMUSP00000140791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
AlphaFold Q8C0X7
Predicted Effect possibly damaging
Transcript: ENSMUST00000027569
AA Change: I310F

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331
AA Change: I310F

low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189547
AA Change: I293F

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331
AA Change: I293F

low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1559:Slco6c1 UTSW 1 97098498 missense probably damaging 1.00
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2005:Slco6c1 UTSW 1 97081489 missense probably damaging 0.99
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R4942:Slco6c1 UTSW 1 97081324 missense probably damaging 1.00
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
R7138:Slco6c1 UTSW 1 97119981 missense possibly damaging 0.95
R7213:Slco6c1 UTSW 1 97127946 missense probably benign
R7234:Slco6c1 UTSW 1 97125741 missense probably benign 0.06
R7320:Slco6c1 UTSW 1 97128162 missense possibly damaging 0.83
R7375:Slco6c1 UTSW 1 97081421 missense possibly damaging 0.58
R7383:Slco6c1 UTSW 1 97075883 nonsense probably null
R7422:Slco6c1 UTSW 1 97081482 missense probably benign 0.17
R7491:Slco6c1 UTSW 1 97127854 missense probably benign 0.32
R7561:Slco6c1 UTSW 1 97072966 missense probably damaging 1.00
R7890:Slco6c1 UTSW 1 97062467 missense possibly damaging 0.59
R8115:Slco6c1 UTSW 1 97072961 missense probably damaging 1.00
R8409:Slco6c1 UTSW 1 97075938 missense probably damaging 0.99
R8422:Slco6c1 UTSW 1 97125783 missense probably damaging 1.00
R8824:Slco6c1 UTSW 1 97128159 missense possibly damaging 0.84
R8905:Slco6c1 UTSW 1 97125666 missense possibly damaging 0.68
R9183:Slco6c1 UTSW 1 97069050 critical splice acceptor site probably null
R9300:Slco6c1 UTSW 1 97066084 missense probably benign 0.37
R9359:Slco6c1 UTSW 1 97062523 missense possibly damaging 0.94
R9374:Slco6c1 UTSW 1 97128102 missense probably benign 0.00
R9403:Slco6c1 UTSW 1 97062523 missense possibly damaging 0.94
R9499:Slco6c1 UTSW 1 97128102 missense probably benign 0.00
R9551:Slco6c1 UTSW 1 97128102 missense probably benign 0.00
R9674:Slco6c1 UTSW 1 97119840 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cccccatacccacctacc -3'
(R):5'- aagaagttagactccagagaacc -3'
Posted On 2013-11-07