Incidental Mutation 'R0940:Olfr1408'
ID81359
Institutional Source Beutler Lab
Gene Symbol Olfr1408
Ensembl Gene ENSMUSG00000062527
Gene Nameolfactory receptor 1408
SynonymsMOR267-4, GA_x6K02T2R7CC-715776-716708
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173128049-173137374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173130453 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 255 (S255P)
Ref Sequence ENSEMBL: ENSMUSP00000143864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073663] [ENSMUST00000200689]
Predicted Effect probably benign
Transcript: ENSMUST00000073663
AA Change: S255P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073345
Gene: ENSMUSG00000062527
AA Change: S255P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-55 PFAM
Pfam:7tm_1 41 289 9.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200689
AA Change: S255P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143864
Gene: ENSMUSG00000062527
AA Change: S255P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-55 PFAM
Pfam:7tm_1 41 289 9.4e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Zkscan1 T C 5: 138,093,170 F55S probably damaging Het
Other mutations in Olfr1408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1408 APN 1 173130411 nonsense probably null
IGL01371:Olfr1408 APN 1 173130531 missense possibly damaging 0.67
IGL01816:Olfr1408 APN 1 173130273 utr 3 prime probably benign
IGL02543:Olfr1408 APN 1 173130334 missense probably damaging 0.99
IGL03104:Olfr1408 APN 1 173130959 missense probably benign 0.00
IGL03183:Olfr1408 APN 1 173130858 missense probably damaging 0.97
R1835:Olfr1408 UTSW 1 173130815 missense probably benign 0.00
R1993:Olfr1408 UTSW 1 173130851 missense possibly damaging 0.65
R1994:Olfr1408 UTSW 1 173130851 missense possibly damaging 0.65
R4438:Olfr1408 UTSW 1 173130302 missense probably benign 0.02
R4948:Olfr1408 UTSW 1 173130959 missense probably benign 0.00
R5088:Olfr1408 UTSW 1 173131039 missense probably damaging 1.00
R5117:Olfr1408 UTSW 1 173130917 missense possibly damaging 0.91
R5118:Olfr1408 UTSW 1 173130917 missense possibly damaging 0.91
R5344:Olfr1408 UTSW 1 173131106 missense probably benign 0.16
X0018:Olfr1408 UTSW 1 173130699 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACACTTTCCGCAGAGCATCCTG -3'
(R):5'- AGGCTGCCATTTTGCAACACAC -3'

Sequencing Primer
(F):5'- AGAGCATCCTGGACTTCTTTG -3'
(R):5'- GTACTGTGCCAGTCATCAATCAAG -3'
Posted On2013-11-07