Incidental Mutation 'R0855:Prdm14'
ID82674
Institutional Source Beutler Lab
Gene Symbol Prdm14
Ensembl Gene ENSMUSG00000042414
Gene NamePR domain containing 14
Synonyms
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location13113457-13127163 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13125537 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 100 (N100I)
Ref Sequence ENSEMBL: ENSMUSP00000044245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047577]
Predicted Effect probably benign
Transcript: ENSMUST00000047577
AA Change: N100I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044245
Gene: ENSMUSG00000042414
AA Change: N100I

DomainStartEndE-ValueType
low complexity region 120 139 N/A INTRINSIC
SET 244 362 2.8e-11 SMART
low complexity region 373 389 N/A INTRINSIC
ZnF_C2H2 390 410 1.4e-1 SMART
ZnF_C2H2 422 445 5.3e-5 SMART
ZnF_C2H2 451 473 3.2e-7 SMART
ZnF_C2H2 479 501 1.4e-4 SMART
ZnF_C2H2 507 530 8.1e-5 SMART
ZnF_C2H2 536 558 4.6e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PRDI-BF1 and RIZ homology domain containing (PRDM) family of transcriptional regulators. The encoded protein may possess histone methyltransferase activity and plays a critical role in cell pluripotency by suppressing the expression of differentiation marker genes. Expression of this gene may play a role in breast cancer. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased primordial germ cell numbers, absent germ cells, and sterility in both males and females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Prdm14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Prdm14 APN 1 13125439 missense probably benign 0.07
R0099:Prdm14 UTSW 1 13118945 missense probably damaging 0.96
R0243:Prdm14 UTSW 1 13122448 missense probably damaging 1.00
R0312:Prdm14 UTSW 1 13118807 missense probably damaging 1.00
R0576:Prdm14 UTSW 1 13125725 missense possibly damaging 0.87
R0781:Prdm14 UTSW 1 13114361 missense probably damaging 0.99
R0791:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0792:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0905:Prdm14 UTSW 1 13125438 missense probably benign 0.00
R1467:Prdm14 UTSW 1 13124532 splice site probably benign
R1747:Prdm14 UTSW 1 13122403 missense possibly damaging 0.83
R1771:Prdm14 UTSW 1 13118858 missense probably damaging 1.00
R2073:Prdm14 UTSW 1 13125730 missense possibly damaging 0.95
R2170:Prdm14 UTSW 1 13122460 missense probably damaging 1.00
R2432:Prdm14 UTSW 1 13125633 missense probably benign
R4948:Prdm14 UTSW 1 13122631 missense probably damaging 1.00
R6267:Prdm14 UTSW 1 13118936 missense probably damaging 1.00
R6902:Prdm14 UTSW 1 13122421 missense probably benign
R7452:Prdm14 UTSW 1 13125559 missense probably damaging 0.98
R8066:Prdm14 UTSW 1 13114316 missense probably benign 0.00
R8265:Prdm14 UTSW 1 13114394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCCATACAGAACGAAGCTCAG -3'
(R):5'- CAGTCACTTTAGGAACCTCGCCAC -3'

Sequencing Primer
(F):5'- GACTGGGACGACTTAATTCCATC -3'
(R):5'- CCACCGAGGAGGAGTTTCAAC -3'
Posted On2013-11-08