Incidental Mutation 'R1119:Thnsl1'
ID97677
Institutional Source Beutler Lab
Gene Symbol Thnsl1
Ensembl Gene ENSMUSG00000048550
Gene Namethreonine synthase-like 1 (bacterial)
Synonyms
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location21205724-21215009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21213046 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 16 (N16S)
Ref Sequence ENSEMBL: ENSMUSP00000115186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054591] [ENSMUST00000102951] [ENSMUST00000102952] [ENSMUST00000138914] [ENSMUST00000138965]
Predicted Effect probably damaging
Transcript: ENSMUST00000054591
AA Change: N537S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052452
Gene: ENSMUSG00000048550
AA Change: N537S

DomainStartEndE-ValueType
Pfam:AAA_17 57 202 2e-8 PFAM
Pfam:SKI 64 221 5.8e-40 PFAM
Pfam:Thr_synth_N 230 318 3.2e-16 PFAM
Pfam:PALP 326 659 2.2e-9 PFAM
low complexity region 684 701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102951
AA Change: N16S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100016
Gene: ENSMUSG00000048550
AA Change: N16S

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102952
AA Change: N16S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100017
Gene: ENSMUSG00000048550
AA Change: N16S

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138914
Predicted Effect probably damaging
Transcript: ENSMUST00000138965
AA Change: N16S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115186
Gene: ENSMUSG00000048550
AA Change: N16S

DomainStartEndE-ValueType
PDB:1KL7|B 2 93 5e-16 PDB
Meta Mutation Damage Score 0.8788 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Thnsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Thnsl1 APN 2 21212449 missense possibly damaging 0.47
IGL00756:Thnsl1 APN 2 21212612 missense probably benign 0.02
IGL00952:Thnsl1 APN 2 21211956 missense possibly damaging 0.89
IGL01020:Thnsl1 APN 2 21212494 missense probably damaging 0.99
IGL01350:Thnsl1 APN 2 21212200 missense probably benign 0.30
IGL01476:Thnsl1 APN 2 21212159 missense probably benign 0.00
IGL01548:Thnsl1 APN 2 21213132 missense probably damaging 1.00
IGL01916:Thnsl1 APN 2 21212665 missense possibly damaging 0.66
IGL02176:Thnsl1 APN 2 21211854 missense possibly damaging 0.69
IGL03001:Thnsl1 APN 2 21211644 missense probably damaging 0.99
IGL03219:Thnsl1 APN 2 21212406 missense probably benign 0.14
IGL03386:Thnsl1 APN 2 21211548 missense probably benign 0.01
R0684:Thnsl1 UTSW 2 21211666 missense probably benign 0.02
R0738:Thnsl1 UTSW 2 21213362 missense probably damaging 1.00
R1121:Thnsl1 UTSW 2 21212164 missense probably benign 0.00
R2150:Thnsl1 UTSW 2 21212533 missense probably benign 0.08
R3545:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R3547:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R4244:Thnsl1 UTSW 2 21212248 missense probably benign
R4245:Thnsl1 UTSW 2 21212248 missense probably benign
R4510:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4511:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4678:Thnsl1 UTSW 2 21211541 splice site probably null
R4753:Thnsl1 UTSW 2 21213364 missense probably damaging 1.00
R4795:Thnsl1 UTSW 2 21212045 nonsense probably null
R4796:Thnsl1 UTSW 2 21212045 nonsense probably null
R5584:Thnsl1 UTSW 2 21213412 missense probably damaging 1.00
R5586:Thnsl1 UTSW 2 21212390 nonsense probably null
R5682:Thnsl1 UTSW 2 21212068 missense possibly damaging 0.69
R5718:Thnsl1 UTSW 2 21212000 missense possibly damaging 0.54
R6159:Thnsl1 UTSW 2 21212205 nonsense probably null
R6795:Thnsl1 UTSW 2 21213492 nonsense probably null
R7084:Thnsl1 UTSW 2 21212330 missense possibly damaging 0.69
R7153:Thnsl1 UTSW 2 21212953 missense possibly damaging 0.64
R7243:Thnsl1 UTSW 2 21212847 missense probably damaging 1.00
R7265:Thnsl1 UTSW 2 21212458 missense probably damaging 1.00
R7481:Thnsl1 UTSW 2 21211788 missense probably benign 0.00
R8005:Thnsl1 UTSW 2 21211944 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCATGCCTCTGCATACCTTGAGC -3'
(R):5'- TGTGGATGCAATGAGCACTGGG -3'

Sequencing Primer
(F):5'- ACCTTGAGCTTGTTAACCAACG -3'
(R):5'- GAAGCTGACTCTCTAACTGATGG -3'
Posted On2014-01-05