Incidental Mutation 'R1121:Thnsl1'
ID95583
Institutional Source Beutler Lab
Gene Symbol Thnsl1
Ensembl Gene ENSMUSG00000048550
Gene Namethreonine synthase-like 1 (bacterial)
Synonyms
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location21205724-21215009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21212164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 243 (D243G)
Ref Sequence ENSEMBL: ENSMUSP00000052452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054591] [ENSMUST00000102951] [ENSMUST00000102952] [ENSMUST00000138914] [ENSMUST00000138965]
Predicted Effect probably benign
Transcript: ENSMUST00000054591
AA Change: D243G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052452
Gene: ENSMUSG00000048550
AA Change: D243G

DomainStartEndE-ValueType
Pfam:AAA_17 57 202 2e-8 PFAM
Pfam:SKI 64 221 5.8e-40 PFAM
Pfam:Thr_synth_N 230 318 3.2e-16 PFAM
Pfam:PALP 326 659 2.2e-9 PFAM
low complexity region 684 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102951
SMART Domains Protein: ENSMUSP00000100016
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102952
SMART Domains Protein: ENSMUSP00000100017
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138914
Predicted Effect probably benign
Transcript: ENSMUST00000138965
SMART Domains Protein: ENSMUSP00000115186
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 93 5e-16 PDB
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Thnsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Thnsl1 APN 2 21212449 missense possibly damaging 0.47
IGL00756:Thnsl1 APN 2 21212612 missense probably benign 0.02
IGL00952:Thnsl1 APN 2 21211956 missense possibly damaging 0.89
IGL01020:Thnsl1 APN 2 21212494 missense probably damaging 0.99
IGL01350:Thnsl1 APN 2 21212200 missense probably benign 0.30
IGL01476:Thnsl1 APN 2 21212159 missense probably benign 0.00
IGL01548:Thnsl1 APN 2 21213132 missense probably damaging 1.00
IGL01916:Thnsl1 APN 2 21212665 missense possibly damaging 0.66
IGL02176:Thnsl1 APN 2 21211854 missense possibly damaging 0.69
IGL03001:Thnsl1 APN 2 21211644 missense probably damaging 0.99
IGL03219:Thnsl1 APN 2 21212406 missense probably benign 0.14
IGL03386:Thnsl1 APN 2 21211548 missense probably benign 0.01
R0684:Thnsl1 UTSW 2 21211666 missense probably benign 0.02
R0738:Thnsl1 UTSW 2 21213362 missense probably damaging 1.00
R1119:Thnsl1 UTSW 2 21213046 missense probably damaging 1.00
R2150:Thnsl1 UTSW 2 21212533 missense probably benign 0.08
R3545:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R3547:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R4244:Thnsl1 UTSW 2 21212248 missense probably benign
R4245:Thnsl1 UTSW 2 21212248 missense probably benign
R4510:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4511:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4678:Thnsl1 UTSW 2 21211541 splice site probably null
R4753:Thnsl1 UTSW 2 21213364 missense probably damaging 1.00
R4795:Thnsl1 UTSW 2 21212045 nonsense probably null
R4796:Thnsl1 UTSW 2 21212045 nonsense probably null
R5584:Thnsl1 UTSW 2 21213412 missense probably damaging 1.00
R5586:Thnsl1 UTSW 2 21212390 nonsense probably null
R5682:Thnsl1 UTSW 2 21212068 missense possibly damaging 0.69
R5718:Thnsl1 UTSW 2 21212000 missense possibly damaging 0.54
R6159:Thnsl1 UTSW 2 21212205 nonsense probably null
R6795:Thnsl1 UTSW 2 21213492 nonsense probably null
R7084:Thnsl1 UTSW 2 21212330 missense possibly damaging 0.69
R7153:Thnsl1 UTSW 2 21212953 missense possibly damaging 0.64
R7243:Thnsl1 UTSW 2 21212847 missense probably damaging 1.00
R7265:Thnsl1 UTSW 2 21212458 missense probably damaging 1.00
R7481:Thnsl1 UTSW 2 21211788 missense probably benign 0.00
R8005:Thnsl1 UTSW 2 21211944 missense probably benign
R8223:Thnsl1 UTSW 2 21212113 missense probably benign 0.45
R8331:Thnsl1 UTSW 2 21212174 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTGAGAGACTCGCTGAAGCAC -3'
(R):5'- CGTTGGGCCATAGAACAACTCCAAG -3'

Sequencing Primer
(F):5'- TCGCTGAAGCACGTAAGACTG -3'
(R):5'- GAGCAGGCAAAGTTTTCCC -3'
Posted On2014-01-05