Incidental Mutation 'R1580:Rfwd3'
ID171357
Institutional Source Beutler Lab
Gene Symbol Rfwd3
Ensembl Gene ENSMUSG00000033596
Gene Namering finger and WD repeat domain 3
Synonyms
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111270944-111300222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111288242 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 326 (R326Q)
Ref Sequence ENSEMBL: ENSMUSP00000043780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038739]
Predicted Effect probably damaging
Transcript: ENSMUST00000038739
AA Change: R326Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043780
Gene: ENSMUSG00000033596
AA Change: R326Q

DomainStartEndE-ValueType
low complexity region 222 243 N/A INTRINSIC
RING 288 331 3.78e-5 SMART
coiled coil region 355 403 N/A INTRINSIC
WD40 486 526 1.38e-2 SMART
WD40 529 568 6.43e-3 SMART
Blast:WD40 683 730 2e-12 BLAST
Blast:WD40 733 772 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212958
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male fertility (possibly infertility), gonad atrophy, oligospermia, failure of follicular development, increased cellular sensitivity to MMC treatment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Rfwd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Rfwd3 APN 8 111273075 missense possibly damaging 0.53
IGL02193:Rfwd3 APN 8 111273015 utr 3 prime probably benign
IGL02282:Rfwd3 APN 8 111293982 splice site probably benign
IGL02903:Rfwd3 APN 8 111278229 missense probably benign 0.00
R0254:Rfwd3 UTSW 8 111294023 missense probably benign
R0279:Rfwd3 UTSW 8 111282733 missense probably benign 0.00
R0531:Rfwd3 UTSW 8 111293989 critical splice donor site probably null
R1137:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1164:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1168:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1191:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1192:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1258:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1259:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1260:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1261:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1439:Rfwd3 UTSW 8 111278288 missense probably damaging 1.00
R1579:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1581:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1727:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1763:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1774:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1785:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R1786:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2059:Rfwd3 UTSW 8 111297495 missense probably benign 0.20
R2130:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2132:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2133:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2145:Rfwd3 UTSW 8 111282613 missense probably benign
R2174:Rfwd3 UTSW 8 111283343 missense probably damaging 0.98
R3897:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R4625:Rfwd3 UTSW 8 111276358 missense probably benign 0.01
R5121:Rfwd3 UTSW 8 111282753 splice site probably null
R5480:Rfwd3 UTSW 8 111273832 missense probably damaging 0.96
R5781:Rfwd3 UTSW 8 111273084 missense probably benign 0.02
Z1088:Rfwd3 UTSW 8 111297606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGCAGGGATCGGGCATAAATGAC -3'
(R):5'- TGTTTAAGGCTCCACCTCAGACACC -3'

Sequencing Primer
(F):5'- TGACAACGATGTCACTGTGC -3'
(R):5'- Acacccccatccccacc -3'
Posted On2014-04-13