Incidental Mutation 'R1202:Ube2o'
ID100217
Institutional Source Beutler Lab
Gene Symbol Ube2o
Ensembl Gene ENSMUSG00000020802
Gene Nameubiquitin-conjugating enzyme E2O
SynonymsB230113M03Rik
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116537740-116581447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116541582 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 853 (D853N)
Ref Sequence ENSEMBL: ENSMUSP00000080791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063396] [ENSMUST00000063446] [ENSMUST00000082152] [ENSMUST00000100201] [ENSMUST00000106386] [ENSMUST00000106387] [ENSMUST00000106388] [ENSMUST00000141798]
Predicted Effect probably benign
Transcript: ENSMUST00000063396
SMART Domains Protein: ENSMUSP00000064743
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063446
SMART Domains Protein: ENSMUSP00000067865
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082152
AA Change: D853N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802
AA Change: D853N

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100201
SMART Domains Protein: ENSMUSP00000097775
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
low complexity region 256 262 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106386
SMART Domains Protein: ENSMUSP00000101994
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106387
SMART Domains Protein: ENSMUSP00000101995
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106388
SMART Domains Protein: ENSMUSP00000101996
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134834
Predicted Effect probably benign
Transcript: ENSMUST00000141798
SMART Domains Protein: ENSMUSP00000131010
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DAGKc 22 159 1.19e-8 SMART
low complexity region 263 269 N/A INTRINSIC
low complexity region 374 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147851
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased MEF proliferation and transformation and increased pre-weaning lethality. Mice heterozygous for the allele exhibit increased total body fat amount, increased startle reflex, increased grip strength and increased circulating HDL cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Ube2o
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ube2o APN 11 116544754 missense probably benign
IGL00973:Ube2o APN 11 116541205 missense probably damaging 1.00
IGL01291:Ube2o APN 11 116540134 missense probably damaging 1.00
IGL01804:Ube2o APN 11 116544373 missense probably benign 0.03
IGL02138:Ube2o APN 11 116543400 splice site probably benign
IGL02317:Ube2o APN 11 116541563 missense probably damaging 1.00
IGL02515:Ube2o APN 11 116543699 missense probably damaging 1.00
IGL02535:Ube2o APN 11 116541765 missense probably benign 0.00
IGL03062:Ube2o APN 11 116541642 missense probably damaging 0.99
IGL03145:Ube2o APN 11 116544009 missense probably damaging 1.00
IGL03190:Ube2o APN 11 116545128 missense probably damaging 1.00
Delay UTSW 11 116540072 missense probably damaging 1.00
Tarry UTSW 11 116541368 missense probably damaging 1.00
ANU05:Ube2o UTSW 11 116540134 missense probably damaging 1.00
R0519:Ube2o UTSW 11 116546459 critical splice donor site probably null
R0666:Ube2o UTSW 11 116542835 missense probably damaging 1.00
R1056:Ube2o UTSW 11 116546464 missense probably damaging 1.00
R1424:Ube2o UTSW 11 116543732 missense probably benign
R1469:Ube2o UTSW 11 116545824 splice site probably benign
R1720:Ube2o UTSW 11 116544607 missense probably benign
R1791:Ube2o UTSW 11 116541494 missense probably benign 0.01
R1893:Ube2o UTSW 11 116548835 missense possibly damaging 0.68
R1997:Ube2o UTSW 11 116545337 missense probably damaging 0.99
R2156:Ube2o UTSW 11 116581146 missense probably damaging 0.98
R2199:Ube2o UTSW 11 116544745 missense probably benign
R2414:Ube2o UTSW 11 116548857 missense probably benign 0.02
R3766:Ube2o UTSW 11 116546863 splice site probably benign
R4749:Ube2o UTSW 11 116541908 missense probably benign 0.11
R5213:Ube2o UTSW 11 116541459 missense possibly damaging 0.82
R5403:Ube2o UTSW 11 116548807 missense possibly damaging 0.48
R5441:Ube2o UTSW 11 116544442 missense probably damaging 1.00
R5727:Ube2o UTSW 11 116539670 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116541378 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116544750 missense possibly damaging 0.50
R6234:Ube2o UTSW 11 116539490 missense probably benign 0.17
R6278:Ube2o UTSW 11 116539543 missense probably damaging 1.00
R6324:Ube2o UTSW 11 116539359 missense probably benign 0.00
R6346:Ube2o UTSW 11 116541368 missense probably damaging 1.00
R6389:Ube2o UTSW 11 116548858 missense probably null 0.72
R7040:Ube2o UTSW 11 116541860 missense probably benign 0.08
R7072:Ube2o UTSW 11 116541501 missense probably benign 0.13
R7270:Ube2o UTSW 11 116543935 missense possibly damaging 0.62
R7420:Ube2o UTSW 11 116540072 missense probably damaging 1.00
R7593:Ube2o UTSW 11 116581079 missense possibly damaging 0.73
R7818:Ube2o UTSW 11 116543910 missense probably damaging 1.00
R7916:Ube2o UTSW 11 116581058 missense probably benign
R8212:Ube2o UTSW 11 116548798 missense possibly damaging 0.54
R8679:Ube2o UTSW 11 116541447 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTACCACTCATGGTGACTCACAGG -3'
(R):5'- TGGACGATGAGCACCCCAAGATAG -3'

Sequencing Primer
(F):5'- AGAGAAGACCTCGCCCTTG -3'
(R):5'- ACAAGGGCGTGGTCATC -3'
Posted On2014-01-15