Incidental Mutation 'R1202:Il23r'
ID100196
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
MMRRC Submission 039272-MU
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67478953 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 177 (V177A)
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118364
AA Change: V177A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: V177A

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1328:Il23r UTSW 6 67491818 start gained probably benign
R1378:Il23r UTSW 6 67452410 missense possibly damaging 0.68
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1475:Il23r UTSW 6 67452296 critical splice donor site probably null
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4164:Il23r UTSW 6 67423663 missense probably benign 0.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5152:Il23r UTSW 6 67423741 missense probably damaging 0.98
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5384:Il23r UTSW 6 67486291 missense probably benign 0.10
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
R6975:Il23r UTSW 6 67423368 missense probably damaging 1.00
R7529:Il23r UTSW 6 67490736 missense possibly damaging 0.84
R7757:Il23r UTSW 6 67423981 missense probably benign 0.02
R7832:Il23r UTSW 6 67423862 missense probably benign 0.08
R7946:Il23r UTSW 6 67434664 missense possibly damaging 0.69
R8078:Il23r UTSW 6 67423593 missense probably damaging 0.99
R8391:Il23r UTSW 6 67452390 missense probably benign 0.27
R8784:Il23r UTSW 6 67466417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTCCCATGAAGCAGAAAATGGC -3'
(R):5'- GGAAGATACTGAATGGGCTTCTGGC -3'

Sequencing Primer
(F):5'- TGGCAATGGCACAGGAGTG -3'
(R):5'- cacacacacacacacacatac -3'
Posted On2014-01-15