Incidental Mutation 'R1202:Tmem209'
ID100194
Institutional Source Beutler Lab
Gene Symbol Tmem209
Ensembl Gene ENSMUSG00000029782
Gene Nametransmembrane protein 209
Synonyms2700094F01Rik
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30479053-30509783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 30508790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 6 (V6L)
Ref Sequence ENSEMBL: ENSMUSP00000115567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031797] [ENSMUST00000031798] [ENSMUST00000064330] [ENSMUST00000102991] [ENSMUST00000115157] [ENSMUST00000115160] [ENSMUST00000131485] [ENSMUST00000138823] [ENSMUST00000148638] [ENSMUST00000151187] [ENSMUST00000154547] [ENSMUST00000222934]
Predicted Effect probably benign
Transcript: ENSMUST00000031797
SMART Domains Protein: ENSMUSP00000031797
Gene: ENSMUSG00000029784

DomainStartEndE-ValueType
Pfam:DUF4636 1 195 3.5e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031798
SMART Domains Protein: ENSMUSP00000031798
Gene: ENSMUSG00000029784

DomainStartEndE-ValueType
Pfam:DUF4636 1 243 1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064330
AA Change: V6L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067667
Gene: ENSMUSG00000029782
AA Change: V6L

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 343 4.1e-88 PFAM
Pfam:CytochromB561_N 341 438 2.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102991
AA Change: V6L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000100056
Gene: ENSMUSG00000029782
AA Change: V6L

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 376 5.2e-107 PFAM
Pfam:CytochromB561_N 372 519 3.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115157
AA Change: V5L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110810
Gene: ENSMUSG00000029782
AA Change: V5L

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 560 4.8e-209 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115160
AA Change: V6L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110813
Gene: ENSMUSG00000029782
AA Change: V6L

DomainStartEndE-ValueType
Pfam:CytochromB561_N 6 560 6.4e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131485
SMART Domains Protein: ENSMUSP00000122018
Gene: ENSMUSG00000029784

DomainStartEndE-ValueType
Pfam:DUF4636 1 67 4.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138823
AA Change: V6L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138292
Gene: ENSMUSG00000029782
AA Change: V6L

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 560 1.2e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148638
AA Change: V6L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000115567
Gene: ENSMUSG00000029782
AA Change: V6L

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 71 1.3e-15 PFAM
Pfam:CytochromB561_N 67 139 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150480
Predicted Effect probably benign
Transcript: ENSMUST00000151187
SMART Domains Protein: ENSMUSP00000138232
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 1 403 1.5e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154547
SMART Domains Protein: ENSMUSP00000145248
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222934
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Tmem209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Tmem209 APN 6 30487417 missense probably damaging 0.99
IGL01068:Tmem209 APN 6 30502086 missense probably benign 0.18
IGL02106:Tmem209 APN 6 30508660 splice site probably null
IGL02109:Tmem209 APN 6 30497945 missense probably damaging 1.00
IGL02250:Tmem209 APN 6 30487388 missense probably damaging 1.00
R0012:Tmem209 UTSW 6 30502113 splice site probably benign
R0426:Tmem209 UTSW 6 30491182 missense probably damaging 0.99
R0452:Tmem209 UTSW 6 30487381 missense probably damaging 1.00
R0557:Tmem209 UTSW 6 30501914 missense probably damaging 0.99
R0690:Tmem209 UTSW 6 30505834 missense probably null 1.00
R1697:Tmem209 UTSW 6 30497868 missense probably benign 0.00
R3821:Tmem209 UTSW 6 30505960 missense probably damaging 1.00
R4795:Tmem209 UTSW 6 30501955 missense probably benign 0.00
R5131:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R5715:Tmem209 UTSW 6 30497923 nonsense probably null
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6153:Tmem209 UTSW 6 30505795 missense probably benign 0.01
R6181:Tmem209 UTSW 6 30505971 missense probably damaging 1.00
R6256:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R6721:Tmem209 UTSW 6 30497175 missense probably benign 0.00
R6873:Tmem209 UTSW 6 30508456 missense probably damaging 1.00
R7062:Tmem209 UTSW 6 30502017 missense probably damaging 1.00
R7341:Tmem209 UTSW 6 30494795 missense probably benign 0.00
R7461:Tmem209 UTSW 6 30508470 nonsense probably null
R7790:Tmem209 UTSW 6 30497855 missense probably damaging 1.00
R8354:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8454:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8527:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
R8542:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
RF020:Tmem209 UTSW 6 30487418 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATACCAGAGGGGCCAGTATGTCAC -3'
(R):5'- CATGGTCAAGGTTAGGGTCTGACAC -3'

Sequencing Primer
(F):5'- TCCAGTCCTGAAAAGATTAGAAAGGC -3'
(R):5'- TTAGGGTCTGACACAGTAATGAC -3'
Posted On2014-01-15