Incidental Mutation 'R1295:Tbx2'
ID158078
Institutional Source Beutler Lab
Gene Symbol Tbx2
Ensembl Gene ENSMUSG00000000093
Gene NameT-box 2
Synonyms
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location85832551-85841948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85834766 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 181 (E181G)
Ref Sequence ENSEMBL: ENSMUSP00000000095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000095]
Predicted Effect probably damaging
Transcript: ENSMUST00000000095
AA Change: E181G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000095
Gene: ENSMUSG00000000093
AA Change: E181G

DomainStartEndE-ValueType
low complexity region 28 75 N/A INTRINSIC
TBOX 104 292 2.44e-130 SMART
Pfam:TBX 305 382 1.5e-18 PFAM
low complexity region 391 408 N/A INTRINSIC
low complexity region 509 549 N/A INTRINSIC
SCOP:d1gkub1 582 612 5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140673
Meta Mutation Damage Score 0.1995 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product is the human homolog of mouse Tbx2, and shares strong sequence similarity with Drosophila omb protein. Expression studies indicate that this gene may have a potential role in tumorigenesis as an immortalizing agent. Transcript heterogeneity due to alternative polyadenylation has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal cardiac and vascular development, edema, and polydactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Tbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02499:Tbx2 APN 11 85840913 missense possibly damaging 0.82
PIT4480001:Tbx2 UTSW 11 85834735 missense probably damaging 1.00
R1296:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1384:Tbx2 UTSW 11 85833492 missense probably benign 0.01
R1501:Tbx2 UTSW 11 85834796 missense probably damaging 1.00
R3949:Tbx2 UTSW 11 85838275 nonsense probably null
R4451:Tbx2 UTSW 11 85840817 missense probably damaging 1.00
R5214:Tbx2 UTSW 11 85838437 missense probably benign 0.02
R5690:Tbx2 UTSW 11 85837053 missense probably damaging 1.00
R6186:Tbx2 UTSW 11 85837846 nonsense probably null
R7211:Tbx2 UTSW 11 85834714 missense probably damaging 1.00
R7353:Tbx2 UTSW 11 85833489 missense probably damaging 0.96
R7529:Tbx2 UTSW 11 85840901 missense probably benign 0.02
R7573:Tbx2 UTSW 11 85833312 missense possibly damaging 0.70
R7626:Tbx2 UTSW 11 85840796 missense probably benign 0.00
R7762:Tbx2 UTSW 11 85835901 missense probably damaging 1.00
R7996:Tbx2 UTSW 11 85834790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTCCAGGTAGCAACACAGCAC -3'
(R):5'- GGCTTGACCCATTCCTTACAGCAC -3'

Sequencing Primer
(F):5'- CAAGTAGGATGTCATGTCATTGTC -3'
(R):5'- TGGAGCTTTCCACAAACAGTC -3'
Posted On2014-02-18