Incidental Mutation 'R1295:Aldh7a1'
ID158100
Institutional Source Beutler Lab
Gene Symbol Aldh7a1
Ensembl Gene ENSMUSG00000053644
Gene Namealdehyde dehydrogenase family 7, member A1
SynonymsD18Wsu181e, Atq1
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location56509687-56572951 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 56546950 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066208] [ENSMUST00000171844] [ENSMUST00000172734] [ENSMUST00000172734] [ENSMUST00000174518] [ENSMUST00000174704]
Predicted Effect probably null
Transcript: ENSMUST00000066208
SMART Domains Protein: ENSMUSP00000065089
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 59 522 1.2e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170309
SMART Domains Protein: ENSMUSP00000127625
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 60 155 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171844
SMART Domains Protein: ENSMUSP00000127652
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 47 121 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171851
Predicted Effect probably null
Transcript: ENSMUST00000172734
SMART Domains Protein: ENSMUSP00000134192
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 59 340 6.3e-74 PFAM
Pfam:Aldedh 338 458 3.2e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172734
SMART Domains Protein: ENSMUSP00000134192
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 59 340 6.3e-74 PFAM
Pfam:Aldedh 338 458 3.2e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174518
SMART Domains Protein: ENSMUSP00000133372
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 31 494 7.3e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174704
SMART Domains Protein: ENSMUSP00000133970
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 57 293 1.4e-54 PFAM
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Aldh7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02690:Aldh7a1 APN 18 56528355 splice site probably benign
IGL02887:Aldh7a1 APN 18 56542216 intron probably benign
R0462:Aldh7a1 UTSW 18 56534214 splice site probably null
R0595:Aldh7a1 UTSW 18 56546893 splice site probably benign
R0657:Aldh7a1 UTSW 18 56537197 splice site probably benign
R0947:Aldh7a1 UTSW 18 56560838 splice site probably null
R1385:Aldh7a1 UTSW 18 56542285 missense probably damaging 1.00
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1517:Aldh7a1 UTSW 18 56532061 missense probably damaging 0.99
R1550:Aldh7a1 UTSW 18 56550382 missense possibly damaging 0.49
R3552:Aldh7a1 UTSW 18 56550292 splice site probably null
R3953:Aldh7a1 UTSW 18 56548505 missense probably damaging 0.99
R4124:Aldh7a1 UTSW 18 56537323 intron probably benign
R4296:Aldh7a1 UTSW 18 56544963 critical splice donor site probably null
R4355:Aldh7a1 UTSW 18 56548494 missense probably null 0.09
R4549:Aldh7a1 UTSW 18 56531994 missense probably benign 0.09
R4851:Aldh7a1 UTSW 18 56532016 missense possibly damaging 0.95
R5288:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5384:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5385:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5547:Aldh7a1 UTSW 18 56528284 missense probably damaging 1.00
R6505:Aldh7a1 UTSW 18 56526996 missense probably damaging 1.00
R7373:Aldh7a1 UTSW 18 56542317 missense possibly damaging 0.48
R7861:Aldh7a1 UTSW 18 56548453 missense probably benign 0.03
R8205:Aldh7a1 UTSW 18 56544998 missense probably damaging 1.00
Z1177:Aldh7a1 UTSW 18 56526991 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTCGCTATGCTGAAACAAACAC -3'
(R):5'- ACACCGCCTGAAGGATAGGTTTCC -3'

Sequencing Primer
(F):5'- aacaaaaaaacaaaaaaacaacccc -3'
(R):5'- GGATAGGTTTCCATTTCAGTCAC -3'
Posted On2014-02-18